AGONIST APTAMERS OF THE FPR2 RECEPTOR AND USES OF THEM (Machine-translation by Google Translate, not

专利摘要:
FPR2 receptor agonist aptamers and uses thereof. The present invention relates to FPR2 receptor agonist aptamers and uses thereof. The present invention relates to a nucleic acid aptamer with the ability to specifically bind to the FPR2 receptor and activate said FPR2 receptor, which comprises a nucleotide sequence with a sequence identity of at least 70% with the sequence SEQ ID NO : 1, SEQ ID NO: 2 or SEQ ID NO: 3. (Machine-translation by Google Translate, not legally binding)
公开号:ES2799098A1
申请号:ES201930524
申请日:2019-06-10
公开日:2020-12-14
发明作者:Trillo Marta Carretero；Arriba Pérez María Del Carmen De；Río Nechaevsky Marcela Andrea Del；Gómez-Chacón Gerónimo Fernández；Muñoz Víctor Manuel González；Marchante Rebeca Carrión；Palma Elena Martín
申请人:Aptus Biotech S L；Centro de Investigaciones Energeticas Medioambientales y Tecnologicas CIEMAT；Fundacion para la Investigacion Biomedica del Hospital Universitario Ramon Y Cajal；Universidad Carlos III de Madrid；Instituto de Investigacion Sanitaria Fundacion Jimenez Diaz；
IPC主号:

专利说明:

[0002] FPR2 receptor agonist aptamers and uses of the same
[0004] The present invention relates to agonist aptamers of the FPR2 receptor and uses thereof in the prophylaxis and / or treatment of a disease, condition or pathology characterized by a decrease or inhibition of the expression of the FPR2 receptor, and / or a decrease or block in the activation of the FPR2 receptor and / or an absence / low amount of the natural ligand of the FPR2 receptor.
[0006] BACKGROUND OF THE INVENTION
[0008] G protein-coupled receptors (GPCRs) constitute the largest family of membrane-bound receptors in the human genome. Although they recognize a wide variety of ligands, such as peptides, small organic molecules, calcium ions and even photons, they have a related structure that includes 7 transmembrane domains. GPCRs modulate a wide variety of physiological processes and numerous mutations have been described in the genes encoding these disease-associated receptors. Therefore, they constitute the main therapeutic targets of the drugs that exist today (approximately 35%).
[0010] The rhodopsin-like GPCRs (GPCRA) is the most studied group from a structural and functional point of view, and it is divided into 19 subfamilies. They represent approximately 80% of all GPCRs. Within this family are the FPRs (Formyl Peptide Receptors). The N-formylated peptides produced by Gram negative bacteria were the first identified ligands for the FPRs FPR1 and FPR2 (FPRL1). At present, multiple agonists and antagonists are known for these receptors, thus presenting a great variety of functions in different systems. Specifically, FPR2 is expressed in a wide variety of cells, including astrocytes, epithelial cells, hepatocytes, endothelial cells, neuroblastoma and leukocytes, which is why it is involved in different physiological and pathological processes, such as the inflammatory response, scarring, angiogenesis and cancer. . Among the known FPR2 agonists is the antimicrobial peptide LL37, whose therapeutic use is protected by patent US20100210539A1 for possible applications in cancer, autoimmune diseases, fibrotic diseases, inflammatory diseases, neurodegenerative diseases, infectious diseases, lung, heart, vascular and metabolic diseases. Also patent EP1358888A1 describes the use of LL37 / hCAP18 as an inducer of angiogenesis and patent US7452864B2 the use of LL37 and peptides derived from it for use in healing. Several studies have been carried out to test the benefits of the LL37 peptide in the chronic treatment of wounds of various etiologies. However, peptides in general, and LL37 in particular, have serious disadvantages in relation to their low activity and availability in the area where the wound is located, which requires the use of repetitive applications of peptides and high doses. of which can lead to toxicity and undesirable side effects.
[0012] Therefore, in view of the above-mentioned drawbacks, there is a need in the state of the art to provide new molecules capable of interacting with, and specifically binding to, rhodopsin-like G-protein-coupled receptors and activating the cascade of reactions associated with them, useful in the treatment of different pathologies associated with defects in said receptors, specifically, in the treatment of wound healing.
[0014] DESCRIPTION OF THE INVENTION
[0016] The authors of the present invention have developed nucleic acid aptamers that act as agonist molecules of GPCR receptors of the rhodopsin type (GPCRA), in particular, of the FPR2 receptor ( "Formyl peptide receptor 2").
[0018] The aptamers of the present invention were obtained using the SELEX method (Systematic Evolution of Ligands by Exponential Enrichment), after which the affinity, cell location and activity of each of them were analyzed (see Example of the present description , Figures 3 and 5 to 8). Thus, it was observed that the aptamers were capable of inhibiting the production of cAMP measured by forskolin, and of activating the migration of the human keratinocyte line HaCaT stably expressing the receptor FPR2. Additionally, an in vivo experiment was also carried out with one of the aptamers of the invention (specifically the aptamer ApFP4.5b) where the procicatrizing action could be observed, inducing an improvement in the re-epithelialization process (see Figure 9).
[0020] These aptamers, thanks to their three-dimensional structure, are able to recognize receptors with high affinity and specificity, bind to them in a specific way, and activate the cascade of reactions associated with them. Therefore, the aptamers provided by the present invention constitute tools with great diagnostic and therapeutic value. Furthermore, as they are single-stranded nucleic acid molecules, they have a series of properties and characteristics that differentiate them from other agonists such as small molecules and antibodies. Among them, they stand out that they are not immunogenic, have reduced cytotoxicity and are easily eliminated, which makes the aptamers of the present invention a highly relevant therapeutic tool for all those diseases characterized in that the FPR2 receptor is totally / partially inhibited or inactivated. or in those diseases in which endogenous receptor ligands are not available or endogenous ligand is available, but an extra supply of exogenous ligand can be beneficial. Additional advantages are the low production costs and the fact that when chemically synthesized they do not present differences between batches.
[0022] Thus, based on these aptamers, the inventors have developed a series of inventive aspects that will be described in detail below.
[0024] Aptamer of the invention
[0026] In one aspect, the present invention relates to a nucleic acid aptamer with the ability to specifically bind to and activate the FPR2 receptor, hereinafter "aptamer of the invention", which comprises a nucleotide sequence with a sequence identity of, at least 70% with a nucleotide sequence selected from the group consisting of the sequences SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
[0028] The term "aptamer", in the context of the present invention, refers to single-stranded nucleic acid chains that adopt a specific tertiary structure that allows them to bind to molecular targets with high specificity and affinity, comparable to that of monoclonal antibodies, to through interactions other than those of Classical Watson-Crick base pairing, such as electrostatic and ionic interactions.
[0030] The term "nucleic acid", in the context of the present invention, refers to any type of nucleic acid, such as DNA and RNA, and to variants thereof, such as peptide nucleic acid (APN, or in English "peptide nucleic acid ' or PNA), the locked nucleic acid (ANB, or in English "locked nucleic acid" or LNA), as well as combinations thereof, modifications thereof, including modified nucleotides, etc. The terms "nucleic acid" and "oligonucleotide" and "polynucleotide" are used interchangeably in the context of the present invention. Nucleic acids can be purified from natural sources, produced using recombinant expression systems, and optionally purified, chemically synthesized, etc. Where appropriate, for example in the case of chemically synthesized molecules, nucleic acids may comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. A nucleic acid sequence is represented in the 5'-3 'direction unless otherwise indicated.
[0032] In the present invention, the term "FPR2" refers to the cellular receptor FPR2, formyl peptide receptor 2, located on the cell surface of a wide variety of cell types, such as neutrophils, monocytes, macrophages, immature dendritic cells. , B cells, T cells, epithelial cells, astrocytes, hepatocytes and endothelial cells, as well as in cells of different animal species. Other names for this receptor include, but are not limited to, ALXR, FMLP-R-II, FMLPX, FPR2A, FPRH1, FPRH2, FPRL1, HM63, and LXA4R.
[0034] In humans, the FPR2 receptor comprises 351 amino acids and is encoded by the FPR2 gene (NCBI Reference Sequence: NC_000019.10, ACCESSION NC_000019 Region: 51752026..51770526, (SEQ ID NO: 4)) within an open reading frame without introns. The gene forms a cluster with the FPR1 and FPR3 genes on chromosome 19q.13.3. The transcription of the FPR2 gene gives rise to two transcripts:
[0035] - NCBI, NM_001005738.2 (SEQ ID NO: 5), whose translation gives rise to the FPR2 receptor that comprises the sequence SEQ ID NO: 6 (NCBI, NP_001005738.1), and - NCBI, NM_001462.3 (SEQ ID NO: 7), whose translation gives rise to the FPR2 receptor that comprises the sequence SEQ ID NO: 8 (NCBI, NP_001453.1).
[0036] In a particular embodiment, the FPR2 receptor is a mouse, rat, rabbit, pig, cat, dog, horse or non-human primate receptor. In another particular embodiment of the aptamer of the invention, the FPR2 receptor is the human FPR2 receptor.
[0038] As explained above, the aptamer of the invention has the ability to specifically bind to the FPR2 receptor, that is, it is capable of specifically recognizing it and binding to it to activate it just as the natural ligand of said receptor would.
[0040] In the present invention, "specific binding" or "specific binding to the FPR2 receptor" is understood as the non-covalent physical association between two molecules, the aptamer of the invention and the FPR2 receptor. The binding between the aptamer of the invention and the FPR2 receptor is considered specific if the binding force between the two is at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 50 times, at least less than 75 times or at least 100 times greater than the strength of the bond between the aptamer of the invention and an irrelevant molecule. The binding between the aptamer of the invention and the FPR2 receptor is also considered specific if the equilibrium dissociation constant Kd is 10.3 M or less, 10.4 M or less, 10.5 M or less, 10.6 M or less, 10'7 M or less, 10'8 M or less, 10'9 M or less, 10'10 M or less, 10'11 M or less, or 10'12 M or less under the conditions used, for example, under physiological conditions, conditions of culture of a cell or conditions that allow cell survival.
[0042] The ability of the aptamer of the invention to specifically bind to the FPR2 receptor can be determined by a variety of assays that are available in the art. Preferably, the specific binding capacity to the FPR2 receptor of the aptamer of the invention is determined by in vitro binding assays, such as the Enzyme-Linked OligoNucleotide Assay (ELONA ), the assay by absorption by Enzyme-Linked Aptamer Sorbent Assay '( ELASA), precipitation and quantitative PCR (qPCR), or by fluorescence techniques such as aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry. Likewise, both the specific binding capacity to the FPR2 receptor and the affinity of the aptamer for the FPR2 receptor can be determined by techniques widely known to those skilled in the art, such as the gel mobility shift assay ( gel mobility shift assay '), surface plasmon resonance ( SPR) ), capillary kinetic electrophoresis and the fluorescence binding assay. Briefly, the fluorescence binding assay consists of the incubation of FPR2 receptor coated magnetic beads with different concentrations (for example, from 0 to 100 nM) of the labeled aptamer of the invention (for example, with carboxyfluorescein, FAM), and the subsequent elution and detection of the attached aptamers, the dissociation constants (Kd) are calculated by non-linear fit analysis.
[0044] As explained above at the beginning of this description, the aptamer of the invention is an agonist of the FPR2 receptor, that is, the aptamer of the invention acts as an activator of said receptor. In the present invention, "activation of the FPR2 receptor" is understood to mean the presence of, or increase of, the signal mediated by the FPR2 receptor with respect to its inactivated state. The activity of a receptor is considered to be increased by an activator or agonist when its activity or the signal mediated by the receptor is greater than the activity or signal mediated by the natural ligand of the receptor. The increase in activity can be at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least less 60%, at least 70%, at least 80%, at least 90% or at least 100% greater than the activity of the receptor when it binds to its natural ligand. The natural ligands of the FPR2 receptor are widely known from the state of the art. Among the natural ligands of FPR2 are N-formylated peptides and other non-endogenous non-formylated bacterial peptides / proteins, such as the gp41 and gp120 proteins of the human immunodeficiency virus type 1 (HIV-1), the Hp2-20 peptide of Helicobacter pylori, the serum amyloid A acute phase protein (SAA), the peptide sequence 106-126 of the PrP protein, the 42 amino acid variant of the amyloid peptide Ap (Ap42), Humanin, Annexin A1 and peptides derived from this protein ( Ac2-26 and Ac9-25), the antimicrobial peptide LL37, peptides derived from uPAR (uPAR D2D388-274 and uPAR84-95), FAM3D, CCL23 and an N-terminal fragment derived from this (SHAAGtide), the vasoactive intestinal neuropeptide VIP , Lipoxin A4 (LXA4), R esolvin D1 and oxLDL. The ability of an aptamer of the invention to activate the FPR2 receptor can be determined by a wide variety of assays available in the state of the art. Preferably, the aptamer capacity of the invention of activating FPR2 is determined by in vitro tests with cells expressing recombinant FPR2 and a reporter gene whose expression is associated with the activation of said recombinant receptors. The person skilled in the art will recognize that there are multiple variants of this method, depending on the cell and the recombinant gene used. An example of this test is collected in the Examples of the present invention (section "Materials and Methods"). Other available techniques include the determination of inflammatory cytokine levels, such as, for example, IL-ip, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, IL-20, IL-31, IL-32, TNF, GM-CSF, CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CXCL1, CXCL4, CXCL8 and CXCL10 among others, released by different cell types that express the FPR2 receptor .
[0046] The aptamer of the invention with the ability to specifically bind to the FPR2 receptor and activate said receptor. FPR2 comprises a nucleotide sequence having a sequence identity of at least 70% to a nucleotide sequence selected from the group consisting of the sequences SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
[0048] In the present invention, "identity" or "sequence identity" is understood as the degree of similarity between two nucleotide or amino acid sequences obtained by aligning the two sequences. Depending on the number of common residues between the aligned sequences, a degree of identity expressed as a percentage will be obtained. The degree of identity between two nucleotide / amino acid sequences can be determined by conventional methods, for example, by standard sequence alignment algorithms known in the state of the art, such as BLAST [Altschul SF et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215 (3): 403-10], BLAST programs, eg, BLASTN, BLASTX, and TBLASTX, BLASTP and TBLASTN, are in the public domain on the website of The National Center for Biotechonology Information (NCBI).
[0050] The person skilled in the art understands that mutations in the nucleotide sequence of genes that give rise to conservative amino acid substitutions in positions that are not critical to the functionality of the protein, are evolutionarily neutral mutations that do not affect its overall structure or its functionality, resulting in variants functionally equivalent to the nucleotide sequence original. Such variants fall within the scope of the present invention. Thus, all those nucleotide sequences that present at least 70% identity with the nucleotide sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and that also present the same function as said sequences, is that is, having the ability to specifically bind to the FPR2 receptor and activate said FPR2 receptor, they are functionally equivalent variants that are also contemplated within the scope of protection of the present invention.
[0052] In the present invention, "functionally equivalent variant" is understood to refer to aptamers with sequences substantially similar to the sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEO ID NO: 3 that maintain their ability to specifically bind and activate the FPR2 receiver. A functionally equivalent variant of the aptamer of the invention can be a nucleic acid sequence derived from the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEO ID NO: 3 comprising the addition, substitution or modification of one or more nucleotides . By way of illustration, functionally equivalent variants of the aptamer of the invention include sequences comprising the addition of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, at least 500 nucleotides, at least 1000 nucleotides or more at the 5 'end of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and / or comprising the addition of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides , 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, at least 500 nucleotides, at least 1000 nucleotides or more at the 3 'end of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and that maintain an ability to specifically bind and activate the FPR2 receptor of at least 50% , at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least minus 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of its capacity to specifically bind and activate the FPR2 receptor.
[0053] The present invention also includes aptamers that comprise nucleotide sequences with a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least the 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99 % with the sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and that maintain an ability to specifically bind and activate the FPR2 receptor of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94 %, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of its ability to specifically bind and activate the FPR2 receptor.
[0055] Thus, in a particular embodiment of the invention, the aptamer comprises a nucleotide sequence that has a sequence identity of at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In a more particular embodiment, the aptamer comprises a nucleotide sequence that has a sequence identity of 100% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In another even more particular embodiment, the aptamer of the invention consists of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
[0057] The aptamers of the present invention are nucleic acid aptamers, which can be DNA or RNA. In a particular embodiment, the aptamer of the invention is a DNA aptamer. However, it is also contemplated in the present invention that the aptamer may be formed from nucleic acid variants and analogs and combinations thereof. Examples of nucleic acid variants and analogs and combinations thereof, including, without limitation, modified nucleic acid backbones, substitution linkages, modified nucleotides, and ribose or deoxyribose analogs, modified nucleotides, etc. with an ability to specifically bind and activate the FPR2 receptor of at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98 %, at least 99%, or at least 100% of the ability to specifically bind and activate the FPR2 receptor of the aptamer comprising the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. Non-limiting examples of nucleic acid variants and analogs include, without limitation, APN, ANB, and ATN.
[0059] The term "nucleic acid variant" or "nucleic acid analog", in the context of the present invention, refers to nucleic acid variants and analogs including, without limitation, modified nucleic acid backbones, substitution linkages , modified nucleotides, and ribose or deoxyribose analogs. For example, nucleic acid variants according to the present invention may comprise structures with synthetic backbones analogous to the typical phosphodiester backbone. These include, without limitation, phosphorothioate, phosphorodithioate, methyl phosphonate, phosphoramidate, alkyl phosphotriester, sulphamate, 3'-thioacetal, methylene (methylimino), 3'-N-carbamate, morpholino carbamate, and peptide nucleic acids (PNAs), methylphosphonate linkages. or alternating methylphosphonate and phosphodiester and benzylphosphonate.
[0061] Variants of a nucleic acid can also contain one or more "replacement" linkages, as is generally understood in the art. Some of these substitution bonds are nonpolar and contribute to providing the aptamer with an ability to diffuse through membranes. These "substitution" linkages are defined herein as conventional alternative linkages such as phosphorothioate or phosphoramidate, and are synthesized as described in commonly available literature. Alternative linking groups include, but are not limited to, embodiments in which a moiety of formula P (0) S, ("lioalo"), P (S) S ("dilioalo"), P (0) NR 'P ( 0) R ', P (0) 0R', CO, or CONR 'where R' is H (or a salt) or an alkyl group of 1-12 C atoms and R6 is an alkyl group of 1-9 atoms of C, which bind to adjacent nucleotides through -So of -0-. The present invention also contemplates the use of substitution linkages that include non-phosphorous-based intermucleotide linkages such as 3'-thioformacetal, (-S-CH2-0-), formacetal (-0-CH2-0-) and intermucleotide linkages 3 'amine (-NH-CH2-CH: d). One or more substitution linkages can be used in the aptamers of the invention in order to further facilitate binding to the FPR2 receptor, or to increase the stability of the aptamers against nucleases, as well as to confer permeation ability. Not all linkages within the same aptamer have to be identical, and therefore the present invention contemplates aptamers with all identical linkages as well as aptamers with a variation in the composition of their linkages.
[0062] Likewise, nucleic acid variants according to the present invention may also contain analogous forms of ribose or deoxyribose that are well known in the art, including without limitation 2 'substituted sugars such as 2'-0-methylribose, 2'-fluororibose or 2 '-azido-ribose, carbocyclic analogs of sugars, α-anomeric sugars, epimeric sugars such as arabinose, xyloses or lixoses, pyranose sugars, furanose sugars and sedoheptuloses. Nucleic acids can also contain treose nucleic acid (ANT, or "threose nucleic acid" or TNA, also referred to as alpha-treofuranosyl oligonucleotides). In particular, the substitution at the 2 'position of the furanose residue is particularly important with regard to improving nuclease stability.
[0064] The term "nucleotide", in the context of the present invention, refers to the monomers that make up nucleic acids. Nucleotides are made up of a pentose, a nitrogenous base and a phosphate group, and are linked by phosphodiester bonds. The nucleotides that are part of DNA and RNA differ in pentose, I feel this deoxyribose and ribose respectively. Nitrogen bases, in turn, are divided into purine nitrogenous bases, which are adenine (A) and guanine (G), and into pyrimidine nitrogenous bases, which are thymine (T), cytosine (C) and uracil (U). Thymine only appears in DNA, while uracil only appears in RNA. The present invention contemplates the use of modified nucleotides in the aptamer of the invention. The term "modified nucleotide" which in the context of the present invention refers to known analogues of natural nucleotides, with similar or improved binding properties. Analogous forms of purines and pyrimidines are well known in the art, and include, without limitation, aziridinylcytosine, 4-acetylcytosine, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, isopenteenine, 6-isopentenyl , 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil , 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, pseudouracil, cheosine, 2-thiocytosine, 5-methyl -2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid, and 2,6-diaminopurine. In addition to the above modified nucleotides, nucleotide residues lacking a purine or a pyrimidine can also be included in the present invention.
[0065] In addition to the above variants, the nucleic acid variants encompassed by the invention also include PNA, ANB, and 5'-5 'or 3'-3' chains. The term "peptidonucleic acid" or "PNA" or "PNA", in the context of the present invention, refers to an oligonucleotide whose backbone is composed of repeating units of N- (2-aminoethyl) glycine linked by peptide bonds, in where the different nitrogenous bases are linked to the main chain by a methylene bond (-CHT) and a carbonyl group (- (C = 0)). The term "blocked nucleic acid" or "ANB" or "LNA", in the context of the present invention, refers to a modified nucleotide of RNA whose ribose residue is modified with an additional bond that connects oxygen 2 'to the 4 'carbon, blocking ribose in the 3'-endo conformation. The term "5'-5 'strand" or "3'-3' strand", in the context of the present invention, refers to oligonucleotides in which the nucleotide at the 3 'or 5' ends, respectively, is inverted.
[0067] The aptamer of the invention comprises a variable size of nucleotides. In a particular embodiment, it comprises a size between 76 and 200 nucleotides, preferably between 76 and 150 nucleotides, more preferably, between 76 and 100 nucleotides, even more preferably, the aptamer of the invention comprises 76 nucleotides.
[0069] The production of the aptamer of the invention can be carried out following methods conventional in the art. Non-limiting examples of aptamer production techniques include commercially available enzymatic techniques, such as transcription, recombinant expression systems, and standard solid phase (or solution phase) chemical synthesis. Where appropriate, for example, where the aptamer of the invention comprises nucleic acid variants as described above, nucleotide analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc., the aptamer of the invention will be produced by chemical synthesis. Alternatively, recombinant expression will be the preferred technique for the production of aptamers when they are 200 nucleotides or longer in length. Aptamers produced by any of the above techniques can optionally be purified by methods well known in the art.
[0070] Invention complex
[0072] As the person skilled in the art will appreciate, the characteristics of small size, stability and easy production of the aptamer of the invention, make it possible for it to be present together with a second molecule. This is particularly advantageous when the second molecule is a functional group. The result of the union of the aptamer of the invention and a functional group is a complex that exhibits the combination of functions of both, that is, a complex with the ability to specifically bind and activate the FPR2 receptor and with the activity associated with the functional group. .
[0074] Thus, in another aspect, the present invention relates to a complex, hereinafter referred to as the "complex of the invention", comprising the aptamer of the invention and a functional group.
[0076] The term "aptamer" has been described in detail in the previous inventive aspect (aptamer of the invention) and its definitions and particularities apply equally to the complex of the invention.
[0078] The term "functional group", in the context of the present invention, refers to molecules capable of exerting at least one function. Said function includes, without limitation, the ability to specifically bind to the FPR2 receptor, or to other receptors for rhodopsin-type GPCRs, such as Formyl Peptide Receptors or FPRs, and activate them, the ability to be detectable, both directly and indirectly, the ability to induce cell death, etc. As the person skilled in the art will understand, a functional group can have one or more functions associated with it. Non-limiting examples of functional groups include detectable reagents and drugs. These functional groups can be to act as imaging agents, drugs, etc. Therefore, in a particular embodiment, the functional group is a detectable reagent, a drug or a nanoparticle.
[0080] The term "detectable reagent", in the context of the present invention, refers to reagents with the ability to be directly or indirectly detectable. Examples of detectable reagents indicated for the present invention include, without limitation, radionuclides, fluorophores, proteins, and haptens.
[0081] In a preferred embodiment, the detectable reagent is a radionuclide. For this purpose, appropriate radionuclides are useful in diagnostic imaging techniques, such as radioimmunodiagnostic techniques and positron emission tomography (PET). Non-limiting examples of radionuclides include gamma emission isotopes, such as 99mTc, 123l and 111ln, which can be used in radioscintigraphy using gamma or gamma cameras or computed single photon emission tomography, as well as positron emitters, such as 18F, 64Cu, 68Ga, 86Y, 124l, 213Bi and 211At, which can be used in PET, or beta emitters, such as 1311, 90Y, 99mTC, 177Lu and 67Cu. The person skilled in the art will appreciate that radionuclides can also be used for therapeutic purposes.
[0083] In another preferred embodiment, the detectable reagent is a fluorophore. The term "fluorophore", in the context of the present invention, refers to a fluorescent chemical compound that can emit light after being excited by light of a different wavelength. Suitable fluorophores in the present invention include, without limitation, Cy3, Cy2, Cy5, the Alexa Fluor® family of fluorescent markers (Molecular Probes, Inc.), carboxyfluorescein (FAM), and fluorescein isothiocyanate (FITO).
[0085] In another preferred embodiment, the detectable reagent is a protein. The term "protein", in the context of the present invention, refers to macromolecules consisting of one or more chains of amino acids. Proteins are responsible for carrying out a diverse group of cellular functions based on their ability to bind other molecules in specific ways. Proteins can bind to other proteins as well as small substrate molecules. Non-limiting examples of proteins suitable for the purposes of the present invention include, without limitation, enzymes, fluorescent proteins, luminescent proteins, and antigens.
[0087] In an even more preferred embodiment, the protein is an enzyme. The term "enzyme", in the context of the present invention, refers to a protein that functions as a highly selective catalyst, accelerating both the rate and the specificity of the metabolic reaction for which it is specific. Non-limiting examples of enzymes suitable for the invention include, without limitation, horseradish peroxydase ( HRP) and alkaline phosphatase. As one skilled in the art will appreciate, enzymes suitable for use in the present invention are Indirectly detectable thanks to their ability to catalyze the modification of a substrate into a compound detectable by colorimetry, chemiluminescence or fluorimetry. Examples of suitable substrates include, without limitation, p-Nitrophenyl phosphate (PNPP), 2,2'-azinobis [3-ethylbenzothiazoline-6-sulfonic acid] (ABTS), o-phenylenediamine (OPD), and 3,3 ', 5,5'-tetramethylbenzidine (TMB).
[0089] Bioluminescent proteins or photoproteins are a particular case of oxidative enzymes that are capable of carrying out a chemical reaction of their specific prosthetic groups, resulting in an emission of light without the need for prior excitation. Non-limiting examples of bioluminescent proteins include firefly luciferase, Renilla luciferase, and aquorin.
[0091] In another even more preferred embodiment, the protein is a fluorescent protein. The term "fluorescent protein", in the context of the present invention, refers to a protein with the ability to emit light when excited at a suitable wavelength for excitation. Non-limiting examples of fluorescent proteins that can be used in the complex of the invention include, without limitation, GFP, GFPuv, BFP, CFP, YFP, EBFP2, mCerulean, mCerulean3, mVenus, mTurquoise, T-Sapphire, citrine, amFP486, zFP506 , zFP538, drFP, DsRed, mCherry, dTomato, mTFP1, TagRFP-T, mK02, mRuby, mKate, mAmethrin, REACh, R-phycoerythrin (R-PE) and Allophycocyanin (APC).
[0093] In another even more preferred embodiment, the protein is a luminescent protein. The term "luminescent protein", in the context of the present invention, refers to a protein capable of emitting light when excited at a suitable wavelength for excitation.
[0095] In another even more preferred embodiment, the protein is an antigen. The term "antigen", in the context of the present invention, refers to a molecule that induces an immune response in the body. Thus, an antigen can be used to generate an antibody that specifically recognizes and binds to it. Non-limiting examples of antigens include, but are not limited to, tumor antigens, such as carcinoembryonic antigen (CEA), HER2, prostate-specific antigen (PSA), and tissue plasminogen activator and their recombinant variants such as Activase®, as well as bacterial antigens. , allergens, etc. As the expert in As matter will appreciate, antigens suitable for use in the present invention are indirectly detectable by virtue of their ability to be specifically recognized by an antibody.
[0097] In another preferred embodiment, the detectable reagent is a hapten. The term "hapten", in the context of the present invention, refers to a group of chemical compounds of small molecular size (generally, less than 10,000 Da) that are antigenic but incapable of inducing a specific immune reaction by themselves. The chemical coupling of a hapten to a large immunogenic protein, called a carrier, generates an immunogenic hapten-carrier conjugate that is capable of inducing a specific immune reaction. Non-limiting examples of vitamins include biotin (vitamin B7), digoxigenin, dinitrophenol (DNP), and nitro-iodophenol (NIP). In a more preferred embodiment, the vitamin is biotin. The term "biotin", in the context of the present invention, refers to a heat stable vitamin, soluble in water and alcohol, also called vitamin H and vitamin B7, characterized by specifically binding to avidin with the highest affinity described up to the date of Kd = 1015 M. As the person skilled in the art will appreciate, biotin is indirectly detectable thanks to its ability to be specifically recognized by avidin or variants thereof such as streptavidin and neutravidin.
[0099] In another particular embodiment, the functional group is a drug. The term "drug", in the context of the present invention, refers to a chemical substance used in the treatment, cure or prevention of a disease, condition, or pathology characterized by a decrease or inhibition of the expression of the FPR2 receptor, and / or a decrease in the activation of the FPR2 receptor. It also refers to that chemical substance used in the treatment, cure or prevention of a disease, condition, or pathology characterized by the non-availability of the endogenous ligands of the FPR2 receptor or, even with endogenous ligand availability, an extra supply of exogenous ligand it could be beneficial. Thus, it has been shown that these receptors are involved in the development and progression of cancer. Furthermore, FPR2 is involved in the control of inflammatory processes, exerting pro- or anti-inflammatory functions depending on the cellular context and the availability of ligands. Chronic inflammation is in many cases responsible for the pathogenesis of many human diseases, in which agonists of the FPR2 receptor could show protective and restorative effects by stimulating anti-inflammatory pathways. Furthermore, FPR2 is expressed in epithelial and endothelial cells, playing a fundamental role in wound repair processes and restoration of the integrity of the barrier function, by activating epithelial cell migration and proliferation processes and favoring neoangiogenesis. Therefore, the diseases or conditions that can be treated with FPR2 aptamers are all those included in the following categories: cancer, inflammatory diseases, autoimmune diseases, metabolic diseases, neurodegenerative diseases, fibrotic diseases, infectious diseases, cardiovascular diseases and pathologies of the epithelial tissue.
[0101] The present invention contemplates that the drug is a nucleic acid. Thus, in a preferred embodiment the drug is a nucleic acid. Nucleic acids suitable as drugs in the context of the complex of the invention include antisense RNA, antisense DNA and small interfering RNAs.
[0103] The present invention contemplates that the drug is a peptide. Thus, in a preferred embodiment the drug is a peptide. The term "peptide", in the context of the present invention, refers to a short chain of amino acids linked by peptide bonds. The peptide will comprise at least 2 amino acids, at least 3 amino acids, at least 4 amino acids, at least 5 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, at least 30 acidic amino acids, at least 40 amino acids, at least minus 50 amino acids, at least 60 amino acids, or at least 70 amino acids. Suitable for the purposes of this invention are, among others, peptides with the ability to bind to a target and to induce or inhibit cell signaling. The term "target-binding peptide", in the context of the present invention, refers to a peptide that comprises a target-binding region. The term "signaling peptide", in the context of the present invention, refers to a peptide with the ability to elicit cell signaling, such as cell receptor agonist peptides. Suitable amino acid sequences for the binding of target molecules include molecular recognition consensus sequences well known in the art.
[0104] In another particular embodiment, the functional group is a nanoparticle. As used in the present description, the term "nanoparticle" refers to colloidal systems of spherical, cylindrical, polyhedral type, etc., or similar shapes, having a size less than or equal to 1 pm, which are in the form individually or forming organized structures (dimer, trimers, etc.), dispersed in a fluid (aqueous solution). In a particular embodiment, the nanoparticles suitable for putting the invention into practice have a size smaller than 1 pm, generally between 1 and 99 nanometers (nm), typically between 5 and 500 nm, preferably between around 10 and 150 nm. In a particular embodiment, the nanoparticles have a mean diameter between 2 and 50nm, preferably between 5 and 20 nm. The mean particle diameter is the maximum mean particle dimension, understanding that nanoparticles do not necessarily have to be spherical. Suitable nanoparticles for use in the present invention include polymeric nanoparticles, lipid nanoparticles, and metallic nanoparticles.
[0106] The polymeric nanoparticles are formed by a polymeric matrix that is anchored to the aptamer of the invention. Examples of biocompatible polymers that can be used in the context of the present invention include, but are not limited to, polyethylenes, polycarbonates, and polyanhydrides.
[0108] Alternatively, the nanoparticles that act as functional groups can be lipid nanoparticles such as a liposome or a micelle. The formation of micelles and liposomes from, for example, lipids that form vesicles, is widely known in the state of the art.
[0110] Also, the nanoparticle can be a metallic nanoparticle. The term "metallic nanoparticle" refers to nanoparticles that comprise a metal and comprise the property known as surface plasmon phenomenon. The surface plasmon of a metal can be measured by any state of the art spectroscopic technique, such as surface plasmon resonance spectroscopy.
[0112] In a particular embodiment, the nanoparticle is a mesoporous magnetic silica nanoparticle.
[0113] Nanoparticles can be functionalized by adding a coating to their surface. For biological applications, the coating surface should be polar to provide high aqueous solubility and prevent aggregation of the nanoparticles.
[0115] The aptamer of the invention can be attached to the nanoparticle by covalent bonds, preferably on the surface of the nanoparticle.
[0117] The union between an aptamer of the invention and a functional group to generate the complex of the invention can be carried out by means of conjugation techniques well known to those skilled in the art. The result is a covalent bond between the aptamer of the invention and the functional group. Conjugation may involve the attachment of primary amines from the 3 'or 5' ends of the aptamer of the invention to the functional group during the chemical synthesis of the aptamer. Alternatively, conjugation can be accomplished by conventional cross-linking reactions, which have the advantage of the much higher chemical reactivity of primary alkyl amine tags versus the aryl amines of the nucleotides themselves. Conjugation methods are well known in the art and are based on the use of cross-linking reagents. Crosslinking reagents contain at least two reactive groups, which target groups such as primary amines, sulfhydryls, aldehydes, carboxyls, hydroxyls, azides, and so on, on the molecule to be conjugated. Crosslinking agents differ in chemical specificity, spacer arm length, spacer arm composition, cleavage spacer arm, and structure. For example, the conjugation of complexes according to the invention can be carried out directly or through a linking moiety, through one or more non-functional groups on the aptamer and / or the functional group, such as amine, carboxyl, phenyl groups, thiol or hydroxyl. More selective binding can be achieved through the use of a heterobifunctional linker. Conventional linkers can be used, such as diisiocyanates, diisothiocyanates, bis (hydroxysuccinimide) esters, carbodiimides, maleimide-hydroxysuccinimide esters, glutaraldehyde and the like, ° hydrazines and hydrazides, such as 4- (4-N-maleimidophenylpyric acid) hydrazide (MPBH).
[0118] Another approach consists in the labeling of aptamers during PCR synthesis by using primers labeled, for example, with a fluorophore. For this, there are various commercial houses available to the person skilled in the art.
[0120] Additionally, in the particular embodiment in which the functional group is a radionuclide, the union between an aptamer according to the invention and the radionuclide can be carried out by chemical coordination, where the aptamer atoms involved in the union donate electrons to the radionuclide. Coordination reactions are widely known in the art and will depend on the radionuclide and reactive group involved in the aptamer.
[0122] In vitro uses of the aptamer of the invention
[0124] The aptamer of the invention has the ability to recognize the FPR2 receptor, bind specifically to it, and activate the signaling associated with said receptors, just as their natural ligands do. This ability of the aptamer of the invention can then be used to detect the presence of the receptor by detecting aptamer-receptor binding.
[0126] Therefore, in another aspect, the present invention relates to the in vitro use of the aptamer of the invention to detect the FPR2 receptor.
[0128] Thus, the ability of an aptamer according to the invention to bind specifically to the FPR2 receptor can be exploited for the indirect detection of said receptor. For this purpose, the person skilled in the art will recognize that a subsequent detection of said aptamer is necessary. Techniques for detecting aptamers are widely known in the art and include, for example, the use of antibodies or probes specific to the aptamer. In this way, once the aptamer of the invention is bound to the FPR2 receptor, an antibody or probe specific to the aptamer would be applied, which in turn can be labeled with a detectable reagent, or that can be detected indirectly by means of an antibody or secondary probe. The technique used to detect the FPR2 receptor will then depend on the type of detectable reagent, and may be techniques based, for example, on fluorimetry, colorimetry or radioactivity.
[0129] The term "probe" or "hybridization probe", in the context of the present invention, refers to a DNA or RNA fragment of variable length, generally between 10 and 1,000 bases in length, which is used to detect the presence of Single stranded nucleic acids (DNA or RNA) that are complementary to the sequence in the probe. The probe hybridizes to the target single-stranded nucleic acid, the base sequence of which allows for base pairing due to the complementarity between the probe and the target nucleic acid. To detect the hybridization of the probe to its target sequence, the probe is labeled with a detectable reagent, such as a radionuclide, a fluorophore or digoxigenin, among others.
[0131] Detection of the binding of the FPR2 receptor with the aptamer of the invention can be carried out by in vitro binding assays, such as the Enzyme-Linked OligoNucleotide Assay (ELONA), the Enzyme-Linked Apfamer Sorbent Assay (ELASA), precipitation and quantitative PCR (qPCR), gel mobility shift assay, Western Blotting, surface plasmon resonance (SPR), capillary kinetic electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy, or flow cytometry.
[0133] In another particular embodiment of the in vitro uses of the invention, the detection of the FPR2 receptor is carried out by a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
[0135] The term "ELONA" or "enzyme-linked oligonucleotide assay" (in English "Enzyme-Linked OligoNucleotide Assay"), in the context of the present invention, refers to a technique analogous to the enzyme-linked absorption immunoassay (in English "Enzyme-Linked ImmunoSorbent Assay", ELISA), where the antibody used to detect the molecule of interest, in this case the FPR2 receptor, is exchanged for a detection aptamer specific for said molecule. The ELISA test is based on the use of labeled antigens or antibody, for example with enzymes, so that the complexes formed between the target antigen and the labeled antibody are enzymatically active complexes. Since one of the components, in this case the antigen, is immobilized on a support , the antigen: antibody complexes are immobilized to the support and, therefore, can be detected by adding a specific substrate for the enzyme. In the case of ELONA, the detection aptamer may be covalently linked to an enzyme, or it may itself be detected by an aptamer-specific secondary antibody that is conjugated to an enzyme. This enzyme catalyzes the transformation of a specific substrate to produce a visible signal. This technique can be modified to exchange the enzyme for another detectable reagent, such as a fluorophore. The terms ELONA and ELASA, or Enzyme-Unked Aptamer Sorbent Assay, are used here interchangeably. In a preferred embodiment, the detection of the FPR2 receptor is carried out by ELONA.
[0137] Similarly, the terms "aptacytochemistry" and "aptahistochemistry", in the context of the present invention, refer to techniques analogous to immunocytochemistry and immunohistochemistry for the detection of the FPR2 receptor on cells and histological sections, respectively, where the antibody that is used to detect the molecule of interest, in this case the FPR2 receptor, is exchanged for an aptamer specific for said molecule. The detection aptamer may be covalently linked to an enzyme, or it may itself be detected by a secondary antibody specific to the aptamer that is conjugated to an enzyme. This enzyme catalyzes the transformation of a specific substrate to produce a visible signal. This technique can be modified to exchange the enzyme for another detectable reagent, such as a fluorophore. In a preferred embodiment the detection of the FPR2 receptor is carried out by aptacytochemistry. In another preferred embodiment, the detection of the FPR2 receptor is carried out by aptahistochemistry.
[0139] Alternatively, the person skilled in the art will recognize that these techniques (ELONA, aptacytochemistry, aptahistochemistry) can be adapted to exchange the detection antibody for a specific probe of the aptamer.
[0141] The term "flow cytometry", in the context of the present invention, refers to a cell analysis technique that involves measuring the light scattering and fluorescence characteristics of cells as they are passed through a beam of light. In addition to light scattering, if the cells are placed in the presence of aptamers labeled with fluorescent molecules prior to their analysis, it is possible to assess which cells possess antigens complementary to the aptamers. used. Fluorescence detection is carried out with flow cytofluorimeters (known as "cytometers" or "FACS"("Fluorescence-Activated Cell Sorter"). This technique, like the previous ones, was initially developed for use with antibodies fluorescently labeled but can be easily adapted for use with the aptamer of the invention.
[0143] As the person skilled in the art will appreciate, a complex comprising a nucleic acid aptamer with the ability to specifically bind and activate the receptor, where said aptamer comprises a nucleotide sequence with a sequence identity of at least 70% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and a detectable reagent is particularly advantageous for detecting the FPR2 receptor, since said detectable reagent makes it possible to detect the aptamer comprised in the complex when it is bound to the FPR2 receiver. The technique used to detect the FPR2 receptor will depend on the type of detectable reagent, and may be techniques based, for example, on fluorimetry, colorimetry or radioactivity.
[0145] Thus, in another aspect, the present invention refers to a complex comprising (i) a nucleic acid aptamer with the ability to specifically bind and activate the FPR2 receptor, which comprises a nucleotide sequence with a sequence identity of, at least, 70% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, and (ii) a functional group to detect the FPR2 receptor. In a particular embodiment, the functional group is a detectable reagent. In another particular embodiment of the in vitro uses of the invention, the detection of the FPR2 receptor is carried out by a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry. The terms "aptamer", "FPR2", "complex", "functional group", "detectable reagent", "ELONA", "aptacytochemistry", "aptahistochemistry" and "flow cytometry" have been described in detail above and their definitions and features are included here by reference.
[0147] Since the techniques of ELISA, immunocytochemistry, immunohistochemistry and flow cytometry are well known in the art, the person skilled in the art will be able to carry out the necessary adaptations to exchange the antibody for the aptamer or complex according to the invention without the need for undue experimentation. .
[0148] As previously described, the aptamer of the invention and the complex of the invention have the ability to specifically bind and activate the FPR2 receptor. Therefore, in another aspect, the present invention relates to the in vitro use of the aptamer of the invention or the complex of the invention to activate the FPR2 receptor. Both the aptamer and the complex of the invention are activators of the FPR2 receptor.
[0150] The detection of the binding of the FPR2 receptor with the aptamer of the invention can also be carried out indirectly by detecting the molecules produced as a consequence of said receptor-aptamer binding. Thus, as a result of such binding, an increase in the production of chemokines and chemokine receptors can be observed in monocytes and macrophages (for example, without being limited to, Gro-a, MDC, MCP-1, MIP-1a and MIP-1P). , increased production of VEGF in monocytes and macrophages, increased mobilization of intracellular Ca + sensitively to pertussis toxin, nuclear translocation of NF-kB, phosphorylation of ERKs, induction of Bcl-xL and inhibition of caspase 3 activity in neutrophils, production of LTB4 in neutrophils, induction of phosphorylation and translocation of p47 (phox) and activation of NADPH oxidase in human fibroblasts, etc. In human keratinocytes, as a result of the binding of the FPR2 receptor with the aptamer of the invention, for example, but not limited to, an increase in the production of cytokines and chemokines can be observed, such as IL-6, IFN-p1, CXCL1, CXCL8 / IL8, TNF-a, GM-CSF, IL-10, CXCL10 / IP-10, MCP-1, CCL20 / MIP3a, etc, induction of Snail and Slug transcription factors, activation of MMP-2 and MMP-9 , activation of MAPK and PI3k / Akt signaling pathways and increased phosphorylation of FAK and paxilin.
[0152] In vitro methods of the invention
[0154] As previously explained, both the aptamer of the invention and the complex of the invention have the ability to recognize and specifically bind to the FPR2 receptor, resulting in the activation of said receptors.
[0156] Therefore, analogously to the in vitro uses described in previous paragraphs, the present invention also relates to an in vitro method for the detection of FPR2 receptor in a biological sample isolated from a subject, hereinafter "first in vitro method of the invention", comprising
[0157] (a) contacting said sample with the aptamer of the invention or the complex of the invention,
[0158] (b) separating the aptamer or complex not bound to the FPR2 receptor, and
[0159] (c) detecting the presence of the aptamer or complex bound to the FPR2 receptor present in the sample.
[0161] In the present invention, "sample" is understood as "biological sample" to cell culture or biological material isolated from a subject. The biological sample can contain any biological material suitable to detect the desired biomarker and can comprise cells and / or non-cellular material from the subject. The sample can be isolated from any suitable tissue or biological fluid such as, for example, blood, plasma, serum, urine, cerebrospinal fluid (CSF), heart, brain. The samples used for the detection of the FPR2 receptor are preferably biological fluids.
[0163] The terms "biological fluid" and "biofluid" are used interchangeably herein and refer to aqueous fluids of biological origin. Biofluid can be obtained from any location (such as blood, plasma, serum, urine, bile, cerebrospinal fluid, vitreous or aqueous humor, or any body secretion), an exudate (such as fluid obtained from an abscess, or any other site of infection or inflammation), or fluid obtained from a joint (such as a normal joint or a joint affected by a disease such as rheumatoid arthritis). The biofluids used for the detection of the FPR2 receptor are preferably blood, plasma, serum or cerebrospinal fluid samples.
[0165] The term "subject" or "individual" refers to a member of a mammalian species, and includes, but is not limited to, domestic animals, and primates including humans; the subject is preferably a human, male or female, of any age or race.
[0167] The terms "aptamer" and "FPR2 receptor" have been described in detail previously in the present description, their definitions and particularities being applicable to the present inventive aspect.
[0168] In a first step, the first method of the invention comprises contacting the biological sample isolated from the subject with the aptamer of the invention or the complex of the invention.
[0170] The aptamer or complex of the invention is applied to the sample in a suitable buffer to allow the binding of the aptamer or complex to the FPR2 receptor molecules that may be present in the sample. Non-limiting examples of suitable buffers to allow binding of the inventive aptamer or complex of the invention to FPR2 receptor molecules include, without limitation, PBS, TBS, phosphate buffer, and citrate buffer. Preferably these buffers contain 1mM MgCh. The amount of aptamer or complex of the invention necessary to detect the FPR2 receptor molecules present in the sample will depend on both the size of the sample and the amount of FPR2 receptor present in the sample, and can be easily determined by optimization procedures. which are common in the art. As a guideline, the concentration of aptamer or complex of the invention is at least 1 fM, at least 10 fM, at least 100 fM, at least 1 pM, at least 10 pM, at least 100 pM, at least 1 nM , at least 10 nM, at least 100 nM, at least 1 pM, at least 10 pM, at least 100 pM or more. Preferably, the aptamer concentration is between 100 pM and 1 pM, more preferably between 1 pM and 100nM, even more preferably between 100pM and 1 nM.
[0172] The aptamer or complex of the invention is incubated with the sample at a suitable temperature and for a sufficient time to allow the aptamer or complex to bind to the FPR2 receptor molecules that may be present in the sample. The temperature is preferably between 20 ° C and 37 ° C. As a guide, the aptamer will be incubated with the sample for at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 30 minutes, at least 60 minutes, at least 120 minutes or more.
[0174] Once the aptamer or the complex of the invention has bound to the FPR2 receptor molecules that may be present in the sample, in a second step of the first method of the invention, the sample is washed to remove the aptamer molecules or complexes that have not bound to the FPR2 receptor.
[0175] After washing, in a third step the presence of the aptamer or complex of the invention bound to the FPR2 receptor present in the sample is detected.
[0177] Since the aptamer of the invention is not itself a detectable molecule, the detection step is an indirect detection step through a second detectable molecule that specifically binds to the aptamer. Detection of the aptamer bound to the FPR2 receptor can be carried out with practically any known antibody or reagent that binds with high affinity to the aptamer of the invention. However, the use of a specific antibody against the aptamer, for example, polyclonal serum, hybridoma supernatants, monoclonal or humanized antibodies and fragments thereof is preferable. Said aptamer specific antibody is conveniently labeled with a detectable reagent. The term "detectable reagent" has been described in detail above and its definition and features are included herein by reference. Said reagent can be detected by means of fluorimetry or colorimetry using apparatus suitable for the type of reagents and the type of sample, which are known to those skilled in the art. By way of example, the sample with the aptamer bound to the FPR2 receptor molecules present is incubated with an antibody specific to the aptamer is conjugated to an enzyme, under conditions similar to the incubation conditions with the aptamer, and the FPR2-aptamer complexes -antibody are detected with the addition of a substrate that is converted by the enzyme to a detectable product, for example, by means of fluorimetry in a fluorescence microscope or by colorimetry in a spectrophotometer. Alternatively, detection can be performed analogously using an aptamer specific probe suitably labeled with a detectable reagent. The person skilled in the art will recognize that the first in vitro method of the invention can be carried out as part of detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility shift assay, Western Blotting, surface plasmon resonance , capillary kinetic electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry.
[0179] In the event that the third step of the first method of the invention comprises the detection of the complex of the invention bound to the receptor FPR2 present in the sample, the detection of the complex according to the invention can be carried out with practically any known antibody or reagent that binds with high affinity to the aptamer of the invention or the functional group. Detection of the aptamer of the invention has been described in detail in previous paragraphs. Similarly, in relation to the functional group, the detection can also be carried out with practically any known antibody or reagent that binds with high affinity to said functional group. For this reason, it is particularly desirable that the functional group is a detectable reagent.
[0181] In a particular embodiment, the functional group is a detectable reagent selected from the group consisting of radionuclides, fluorophores, proteins, and haptens. The terms "radionuclide", "fluorophore", "detectable protein" and "hapten" have been described in detail above and their definitions and particulars are included herein by reference.
[0183] As the person skilled in the art will appreciate, the detectable reagents contemplated by the present invention can be divided between reagents that are directly detectable by themselves, such as radionuclides or fluorophores, and reagents that are indirectly detectable, such as proteins or the haptens. In a particular embodiment, the detectable reagent is a radionuclide and the detection is carried out by detecting the radiation emitted by the radionuclide. Said radiation will depend on the type of radionuclide, and may be an emission of particles a, particles p or emission of type y. To this end, suitable detection techniques for the different radionuclides are widely known. By way of example, the emission emitted by 123l can be detected by a gamma camera.
[0185] In another particular embodiment, the detectable reagent is a fluorophore and the detection is carried out by detecting the fluorescence emitted by the fluorophore. The use of a fluorophore requires prior excitation of it with a wavelength within its excitation spectrum, which causes an emission at a different wavelength. The excitation and emission wavelengths of the fluorophores contemplated in the present invention are part of the state of the art. The emitted fluorescence can be detected, for example, by fluorometric techniques using a fluorescence spectrophotometer or a fluorescence microscope.
[0187] In another particular embodiment, the detectable reagent is a protein. This can be detected depending on the type of protein used. For example:
[0188] - an enzyme requires the addition of its specific substrate that will be detectable by colorimetry, chemiluminescence or fluorimetry;
[0189] - a fluorescent protein, like a fluorophore, requires excitation at a suitable wavelength to be detectable by fluorimetry
[0190] - an antigen or a hapten requires an antibody or other molecule that specifically recognizes it. In order to be detected, said antibody or molecule specific for the antigen / hapten needs to be labeled, for example, with an enzyme, and the detection will depend on the type of marking.
[0192] The person skilled in the art will recognize that the third step of the first in vitro method of the invention can be carried out as part of detection techniques such as ELONA, ELASA, precipitation and qPCR, gel mobility shift assay, Western Blotting, resonance surface plasmon, kinetic capillary electrophoresis, fluorescence binding assay, aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry. All these techniques have been explained in previous paragraphs of the present description, and said explanations are applicable to the present inventive aspect. In a particular embodiment, the detection of FPR2 is carried out by means of fluorescence.
[0194] In another aspect, the invention relates to an in vitro method for activating the FPR2 receptor in a biological sample isolated from a subject, hereinafter "second in vitro method of the invention", which comprises contacting said sample comprising the FPR2 receptor with the aptamer of the invention or the complex of the invention, under the appropriate conditions to activate the FPR2 receptor.
[0196] The terms "aptamer", "FPR2 receptor", "FPR2 activation", "sample" and "subject" have been described in detail above and their definitions and particulars are included herein by reference.
[0198] In a particular embodiment, the FPR2 receptor of the sample is comprised in living cells.
[0200] The term "suitable conditions to activate the FPR2 receptor", in the context of the present invention, refers to the incubation conditions that allow the binding of the aptamer or the complex of the invention to the FPR2 receptor and its subsequent activation.
[0201] These conditions include the composition of the buffer in which the aptamer or complex of the invention is applied to the sample, the amount of aptamer or complex, the incubation time and the incubation temperature. Non-limiting examples of suitable buffers to allow the binding of the aptamer of the invention to the FPR2 receptor and its subsequent activation include, but are not limited to, PBS, TBS, phosphate buffer, and citrate buffer. Preferably these buffers contain 1 mM MgCh. The amount of aptamer or complex of the invention necessary to detect the FPR2 receptor molecules present in the sample will depend on both the size of the sample and the amount of FPR2 receptor molecules present in the sample, and can be easily determined by methods of optimization that are common in the art. The aptamer or complex concentrations of the invention have been previously described in the present description for other inventive aspects. The aptamer is incubated with the sample at a suitable temperature and for a time sufficient to allow the binding of the aptamer or the complex of the invention to the FPR2 receptor molecules that may be present in the sample. The temperature is preferably between 20 ° C and 37 ° C, more preferably 37 ° C. As a guide, the aptamer will be incubated with the sample for at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 30 minutes, at least 60 minutes, at least 120 minutes, or more. .
[0203] In a particular embodiment of the second method of the invention, the subject is a human being. In another particular embodiment of the second method of the invention, the biological sample is blood, plasma, serum or cerebrospinal fluid. These terms have been defined in previous paragraphs of this description.
[0205] Composition of the invention
[0207] As the person skilled in the art understands, both the aptamer of the invention and the complex of the invention can form part of a composition, more specifically, a pharmaceutical composition if it is to be administered to an individual for therapeutic purposes.
[0209] Thus, in another aspect, the present invention relates to a pharmaceutical composition, hereinafter "pharmaceutical composition of the invention", which it comprises the aptamer of the invention and / or the complex of the invention, together with a pharmaceutically acceptable carrier, excipients and / or vehicle.
[0211] As explained at the beginning of the present description, the aptamer of the invention is a nucleic acid aptamer with the ability to specifically bind to the FPR2 receptor and activate it, which comprises a nucleotide sequence with a sequence identity of at least one 70% with the nucleotide sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. If the aptamer of the invention has a functional group attached, then we have the complex of the invention. The terms "aptamer", "FPR2 receptor", "activation", "sequence identity", "complex" and "functional group" have been previously defined, as well as the particular embodiments thereof, which are applicable to the present aspect. inventive.
[0213] The composition of the invention may comprise more than one aptamer of the invention, wherein the aptamers comprise different nucleotide sequences between them. Thus, in a particular embodiment, the composition of the invention comprises aptamers that comprise the nucleotide sequence SEQ ID NO: 1, and aptamers that comprise the nucleotide sequence SEQ ID NO: 2. In another particular embodiment, the composition of the invention comprises aptamers that comprise the nucleotide sequence SEQ ID NO: 1 and aptamers that comprise the nucleotide sequence SEQ ID NO: 3. In another particular embodiment, the composition of the invention comprises aptamers that comprise the sequence SEQ ID NO: 2 and aptamers that comprise the sequence SEQ ID NO: 3. In another particular embodiment, the composition of the invention comprises aptamers that comprise the nucleotide sequence SEQ ID NO: 1, aptamers that comprise the nucleotide sequence SEQ ID NO: 2 and aptamers that comprise the nucleotide sequence SEQ ID NO: 3 Within the composition of the invention are also contemplated functionally equivalent variants of the aptamers that comprise in the sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, wherein said variants have a sequence identity of, at least 70%, with the sequence SEQ ID NO: 1, SEQ ID NO : 2 or SEQ ID NO: 3. The terms sequence identity and functionally equivalent variant have been defined for the aptamer of the invention. As understood by the person skilled in the art, these particular embodiments also apply to the complex of the invention.
[0214] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" or "pharmaceutically acceptable solvent" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, antibacterial and antifungal agents, absorption and isotonics, and the like, compatible with pharmaceutical administration. The use of such carriers and vehicles in pharmaceutically active substances is well known in the art. Except insofar as any conventional carrier is incompatible with the active compound, its use in the compositions of the invention is contemplated. Acceptable carriers, excipients, or acceptable stabilizers are not toxic to the subject at the doses and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; benzene alkyl such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol, and m -cresol); low molecular weight polypeptides (less than about 10 amino acids); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or Usine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counter ions such as sodium; metal complexes (eg, Zn-protein complexes); and / or nonionic surfactants such as TWEEN ™, PLURONICS ™ or polyethylene glycol (PEG).
[0216] Supplementary active compounds can also be incorporated into the pharmaceutical composition provided by the present invention. Therefore, in a particular embodiment, the pharmaceutical composition provided by the present invention may also comprise more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, it may be desirable to further provide a chemotherapeutic agent, a cytokine, an analgesic agent, an anti-inflammatory agent, or an immunosuppressive agent. The effective amount of such other active agents depends, among other things, on the therapeutic amount of the aptamers or complexes that are present in the pharmaceutical composition, the nature and severity of the disease to be treated, the subject, etc.
[0218] The aptamers or the complex of the invention may be in the composition of the invention in a therapeutically effective amount. The term "a therapeutically effective amount", in the context of the present invention, refers to the amount of the aptamer or complex of the invention that is required to achieve prevention, cure, delay, reduction in severity of, or improvement of one or more noticeable symptoms of the pathology characterized by a decrease in expression of the FPR2 receptor and / or a decrease in the activation of the FPR2 receptor, and / or an absence / low amount of the natural ligand of the FPR2 receptor (low amount with respect to the amount of natural ligand in normal health conditions).
[0220] In a particular embodiment of the composition of the invention, the aptamer of the invention or the complex of the invention are formulated with vehicles that will protect said products against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for the preparation of such formulations will be apparent to those skilled in the art.
[0222] The pharmaceutical composition provided by the present invention may be administered to a subject by any suitable route of administration, such as, for example, but not limited to, parenterally, orally, topically, ophthalmic, inhalational, or intranasal.
[0224] The term "parenteral", in the context of the present invention, includes intravenous, intraperitoneal, intramuscular, or subcutaneous administration. The intravenous form of parenteral administration is generally preferred.
[0226] Furthermore, the pharmaceutical compositions provided by the present invention can be suitably administered by pulse infusion, for example, with decreasing doses of the aptamer or complex of the invention. Preferably, the dosage is provided by injections, more preferably injections. intravenous or subcutaneous, depending in part on whether the administration is brief or chronic.
[0228] In another particular embodiment, the pharmaceutical compositions provided by the present invention can be adapted for parenteral administration with the addition of sterile solutions, suspensions or lyophilized products in the appropriate dosage form. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or sterile dispersions or powders for the preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable vehicles include physiological saline, CremophorEM bacteriostatic water (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid to facilitate injectability. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a pharmaceutically acceptable polyol such as glycerol, propylene glycol, liquid polyethylene glycol, and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents in the composition, for example, sugars, poly alcohols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and / or gelatin.
[0230] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound (eg, an aptamer or complex of the invention) in an appropriate solvent with one or a combination of the ingredients listed above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for Preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze drying which produces a powder of the active ingredient plus any additional desired ingredients from a sterile previously filtered solution thereof.
[0232] In a particular embodiment, said pharmaceutical composition is administered through the intravenous route. Suitable excipients can be used, such as bulking agents, buffering agents, or surfactants. The formulations mentioned will be prepared using standard methods such as those described or contemplated in the Spanish and United States pharmacopoeias and similar reference texts.
[0234] It is especially advantageous to formulate pharmaceutical compositions, namely parenteral compositions, in unit dosage form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suitable as unit dosages for the subject to be treated; each unit containing a predetermined quantity of active compound (an aptamer or complex of the invention) calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and depend directly on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the technique of compounding such an active compound for the treatment of subjects. .
[0236] The pharmaceutical compositions containing compounds of the invention may be in a form suitable for oral use, for example, as tablets, lozenges, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. . Compositions intended for oral use can be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of a sweetening agent such as sucrose, lactose or saccharin, flavoring . Agents such as peppermint, wintergreen or cherry oil, colorants and preservatives to provide pharmaceutically elegant and palatable preparations. Tablets containing compounds of the invention in admixture with Non-toxic pharmaceutically acceptable excipients can also be manufactured by known methods. The excipients used can be, for example, (1) inert diluents such as calcium carbonate, lactose, calcium phosphate or sodium phosphate; (2) granulating and disintegrating agents such as corn starch, potato starch, or alginic acid; (3) binding agents such as gum tragacanth, cornstarch, gelatin, or acacia, and (4) lubricating agents such as magnesium stearate, stearic acid, or talc.
[0238] The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thus provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed.
[0240] In some cases, formulations for oral use may be in the form of hard gelatin capsules in which the compounds of the invention are mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin. They can also be in the form of soft gelatin capsules in which the compounds of the invention are mixed with water or an oily medium, for example, peanut oil, liquid paraffin or olive oil.
[0242] The pharmaceutical compositions containing compounds of the invention may be in a form suitable for topical use, for example, as oily suspensions, as solutions or suspensions in aqueous liquids or nonaqueous liquids, or as oil-in-water or water-in-oil liquid emulsions. .
[0244] For ophthalmic application, preferably solutions are prepared using physiological saline as the main vehicle. The pH of such ophthalmic solutions should preferably be kept between 4.5 and 8.0 with an appropriate buffer system, with a neutral but not essential pH being preferred. The formulations may also contain conventional pharmaceutically acceptable preservatives, stabilizers, and surfactants.
[0246] Preferred preservatives that can be used in the pharmaceutical compositions of the present invention include, but are not limited to, benzalkonium chloride, chlorobutanol, thimerosal, phenylmercuric acetate, and phenylmercuric nitrate. A preferred surfactant is, for example, Tween 80. Also, various preferred carriers can be used in the ophthalmic preparations of the present invention. These carriers include, but are not limited to, polyvinyl alcohol, povidone, hydroxypropyl methyl cellulose, poloxamers, carboxymethyl cellulose, hydroxyethyl cellulose, cyclodextrin, and purified water.
[0248] Tonicity adjusters can be added as needed or convenient. They include, but are not limited to, salts, particularly sodium chloride, potassium chloride, mannitol and glycerin, or any other suitable ophthalmically acceptable tonicity adjuster.
[0250] Various buffers and means can be used to adjust the pH as long as the resulting preparation is ophthalmically acceptable. Accordingly, the buffers include acetate buffers, citrate buffers, phosphate buffers, and borate buffers. Acids or bases can be used to adjust the pH of these formulations as necessary.
[0252] Similarly, an ophthalmically acceptable antioxidant for use in the present invention includes, but is not limited to, sodium metabisulfite, sodium thiosulfate, acetylcysteine, butylated hydroxyanisole, and butylate.
[0254] Other excipient components that can be included in ophthalmic preparations are chelating agents. The preferred chelating agent is disodium edodate, although other chelating agents may also be used instead or in conjunction with it. Ingredients are generally used in the following amounts: ingredient amount (% w / v), active ingredient around 0.001-5 preservative 0-0.10, vehicle 0-40, tonicity adjuster 0-10, buffer 0.01 -10, pH adjuster q .s. pH 4.5-7.8, antioxidant as required, surfactant as required, purified water to make 100%.
[0256] The active compounds (aptamer or complex of the invention) will typically be administered one or more times a day, for example 1, 2, 3 or 4 times daily, with typical total daily doses in the range of 0.0001 to 1,000 mg / kg body weight / day, preferably about 0.001 to about 100 mg / kg body weight body weight / day, more preferably about 0.01 to 10 mg / kg of body weight / day. The pharmaceutical compositions can be formulated so as to contain the desired amount, such as a therapeutically effective amount of the aptamer or complex of the invention.
[0258] The pharmaceutical compositions provided by the present invention can be included in a container, pack, or dispenser together with instructions for their administration.
[0260] Medical uses of the aptamer, complex or composition of the invention
[0262] The underlying cause of many diseases is due to the low activity or inhibition of a cellular receptor, which entails the blocking or inhibition of the biological pathway dependent on the activation of said receptor. Therefore, a molecule that acts as an activator or agonist of a cellular receptor, and that is capable of increasing or activating the associated biological pathway, can be useful in the prophylaxis or treatment of a disease.
[0264] Therefore, in one aspect, the present invention relates to the aptamer of the invention, a complex of the invention or the composition of the invention for use as a medicine.
[0266] In another aspect, the present invention relates to the aptamer of the invention, a complex of the invention or the composition of the invention, for use in the prophylaxis / prevention and / or treatment of a disease, condition or pathology characterized by a decrease or inhibition of the expression of the FPR2 receptor, and / or a decrease or block in the activation of the FPR2 receptor, and / or an absence / low amount of the natural ligand of the FPR2 receptor (low amount compared to the amount of natural ligand in a subject normal health conditions).
[0268] In the present invention, "absence" is understood as when the natural ligand of the receptor is in such low concentrations that its presence cannot be detected. In the present invention, it is understood that an individual / subject presents "normal health conditions" or is "healthy" when the individual does not present a symptom, sign or indication that he or she suffers from a disease or is ill.
[0269] In the present invention, "treatment" or "therapy" is understood as clinical intervention in an attempt to cure, delay, reduce the severity of, or improve one or more symptoms of the pathology characterized by a decrease or inhibition of the expression of the FPR2 receptor, and / or a decrease or block in the activation of the FPR2 receptor, and / or an absence / low amount of the natural ligand of the FPR2 receptor (low amount compared to the amount of natural ligand under normal health conditions). In the present invention, "prophylaxis" or "prevention" or "prevent" is understood as the action of preventing the development or progress of a disease or pathology as indicated above.
[0271] In a particular embodiment, the disease is selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a neurodegenerative disease, a cardiovascular disease, an infectious disease, a lung disease, a vascular disease, a metabolic disease, a disease ocular and epithelial disease.
[0273] The term "cancer", as used herein, also refers to tumors, proliferative diseases, malignant tumors and their metastases. Examples of cancerous diseases include, but are not limited to, adenocarcinoma, choroidal melanoma, acute leukemia, acoustic neuroma, ampullary carcinoma, anal carcinoma, astrocytoma, basal cell carcinoma, pancreatic cancer, desmoid tumor, bladder cancer, bronchial carcinoma, lung cancer non-small cell (NSCLC), Breast cancer, Burkitt's lymphoma, corpus cancer, CUP syndrome (carcinoma of unknown primary origin), colorectal cancer, cancer of the small intestine, tumors of the small intestine, ovarian cancer, endometrial carcinoma, ependymoma , types of epithelial cancer, Ewing tumors, gastrointestinal tumors, gastric cancer, gallbladder cancer, gallbladder carcinomas, uterine cancer, cervical cancer, cervix, glioblastomas, gynecological tumors, ear, nose and throat tumors, neoplasms haematological, hairy cell leukemia, urethral cancer, skin cancer, skin testicular cancer, brain tumors (gliomas), metastases c Erebral, testicular cancer, pituitary tumor, carcinoids, Kaposi's sarcoma, laryngeal cancer, germ cell tumor, bone cancer, colorectal carcinoma, head and neck tumors (tumors of the ear, nose and throat area), carcinoma colon, craniopharyngiomas, oral cancer (cancer in the mouth area and in lips), central nervous system cancer, liver cancer, liver metastases, leukemia, eyelid tumor, lung cancer, lymph node cancer (Hodgkin's / Non-Hodgkin's), lymphomas, stomach cancer, malignant melanoma, malignant neoplasm , Malignant tumors of the gastrointestinal tract, breast carcinoma, rectal cancer, medulloblastomas, melanoma, meningiomas, Hodgkin's disease, mycosis fungoides, nasal cancer, neurinoma, neuroblastoma, kidney cancer, renal cell carcinomas, non-Hodgkin's lymphomas, oligodendroglioma, esophageal carcinoma, osteolytic carcinomas and osteoplastic carcinomas, osteosarcomas, ovarian carcinoma, pancreatic carcinoma, pancreatic carcinoma, pancreatic carcinoma, plasmyocytoma, squamous cell carcinoma and neck (SCCHN), prostate cancer, carcinoma of the rectum , retinoblastoma, vaginal cancer, thyroid carcinoma, Schneeberger's disease, esophageal cancer, spinaliomas, cell lymphoma T (mycosis fungoides), thymoma, tube carcinoma, eye tumors, urethral cancer, urological tumors, urothelial carcinoma, vulvar cancer, appearance of warts, soft tissue tumors, soft tissue sarcoma, Wilm's tumor, cervical carcinoma and Tongue cancer.
[0275] The aptamer of the invention, the complex of the invention or the composition of the invention are useful for the prevention and / or treatment of eye diseases including, but not limited to, uveitis, dry eye, keratitis, allergic eye disease, infectious keratitis , herpetic keratitis, corneal angiogenesis, lymphangiogenesis, uveitis, retinitis and choroiditis, such as acute placoid pigmentary multifocal epitheliopathy, Behcet's disease, postoperative corneal wound healing, conditions caused by laser, conditions caused by photodynamic therapy, age-related macular degeneration Wet and dry (ARMD), conditions affecting the back of the eye, such as maculopathies and retinal degeneration, including age-related non-exudative macular degeneration, exudative age-related macular degeneration, choroidal neovascularization, retinopathy diabetic (proliferative), retinopathy of prematurity (ROP), neuroreti acute macular nopathy; central serous chorioretinopathy, cystoid macular edema, and diabetic macular edema; avian retinochoroidopathy, intermediate uveitis (pars planitis), multifocal choroiditis, multiple evanescent white dot syndrome (MEWDS), ocular sarcoidosis, posterior scleritis, seriginous choroiditis, subretinal fibrosis and uveitis syndrome, Koyanagi and Harada syndrome; vascular diseases / exudative diseases such as retinal occlusive disease occlusion, central retinal vein occlusion, cystoid macular edema, disseminated intravascular coagulopathy, retinal branch vein occlusion (ORVR), fundus hypertension changes, ocular ischemia syndrome, arterial microanurysms of the retina, Coat's disease, juxtafoveal telangiectasias, hemi-retinal vein occlusion, papilloflebitis, central retinal artery occlusion, occlusion of a branch of the retinal artery, carotid artery disease (CAD), frosty branch angiits ( Frosted branch angiitis), sickle cell retinopathy and other hemoglobinopathies, angioid striae, familial exudative vitreoretinopathy and Eales disease; traumatic / surgical conditions such as sympathetic ophthalmia, uveitic retinal disease, retinal detachment, trauma, conditions caused by photodynamic therapy, photocoagulation, hypoperfusion during surgery, radiation retinopathy, and bone marrow transplant retinopathy; proliferative disorders such as proliferative vitreous retinopathy and epiretinal membranes, and proliferative diabetic retinopathy; infectious disorders such as ocular histoplasmosis, ocular toxocariasis, presumed ocular histoplasmosis syndrome (POHS), endophthalmitis, toxoplasmosis, retinal diseases associated with HIV infection, choroidal disease associated with HIV infection, disease uveitis associated with HIV infection, viral retinitis, acute retinal necrosis, progressive external retinal necrosis, fungal retinal diseases, ocular syphilis, ocular tuberculosis, diffuse unilateral subacute neuroretinitis and myiasis; Genetic disorders such as retinitis pigmentosa, systemic disorders with associated retinal dystrophies, congenital stationary night blindness, cone dystrophies, Stargardt disease and fundus flavimaculatus, Best's disease, pattern dystrophy of the retinal epithelium. pigmented epithelium), X-linked retinoschisis , Sorsby's fundus dystrophy, benign concentric maculopathy, Bietti crystalline dystrophy, and elastic pseudoxanthoma; tears / holes in the retina, such as retinal detachment, macular hole, and giant retinal tear; Tumors such as tumor-associated retinal disease, congenital hypertrophy of the retinal pigment epithelium, posterior uveal melanoma, choroidal hemangioma, choroidal osteoma, choroidal metastasis, combined hamartoma of the retina and retinal epithelium. pigmented epithelium or CHRRPE), retinoblastoma, vasoproliferative ocular fundus tumors, retinal astrocytoma, and intraocular lymphoid tumors; and other various diseases that affect the back of the eye, such as punctate internal choroidopathy, acute posterior multifocal placoid pigment epitheliopathy, myopic retinal degeneration and acute retinal pigment epithelitis, postsurgical corneal inflammation, blepharitis, MGD, glaucoma, ramus occlusion, Best's vitelliform macular degeneration retinitis pigmentosa, proliferative vitreoretinopathy (PVR) and any other degenerative disease of the photoreceptors or retinal epithelial pigment (RPE).
[0277] In the present invention, "autoimmune disease" is understood to be any of a group of diseases or disorders in which tissue damage is associated with a humoral and / or cellular immune response to body constituents or, in a broader sense , an immune response to oneself. The pathological immune response can be systemic or organ specific. That is, for example, and without being limited to, the immune response directed at oneself can affect the joints, the skin, the myelin sheath that protects neurons, kidneys, liver, pancreas, thyroid, adrenals and ovaries.
[0279] Examples of autoimmune diseases of the eyes include, but are not limited to, idiopathic optic neuritis, sympathetic ophthalmia, anterior and other forms of uveitis, retinal degeneration, and Mooren's ulcer. Examples of autoimmune skin diseases include, but are not limited to, bullous pemphigoids, chronic urticaria (autoimmune subtype), dermatitis herpetiformis (Morbus Duhring), epidermolysis bullosa aquisita (EBA), acquired angioedema, herpes gestation, hypercomplemic urticarial vasculitis (HUV), and pemphigus. Examples of hematologic autoimmune diseases include, but are not limited to, autoimmune hemolytic anemia, autoimmune neutropenia, Evans syndrome, inhibitory hemophilia, idiopathic thrombocytopenic purpura (ITP), and pernicious anemia. Some examples of autoimmune heart diseases include, but are not limited to, congenital heart block, idiopathic dilatative cardiomyopathy, peripartum cardiomyopathy, postcardiotomy syndrome, and post-infarction syndrome (Dressler's syndrome). Some examples of autoimmune diseases of the ear, nose, and throat include, but are not limited to, chronic sensorineural hearing loss and Morbus Meniere. Examples of autoimmune diseases of the colon include, but are not limited to, autoimmune enteropathy, ulcerative colitis, indeterminate colitis, Crohn's disease, and gluten-sensitive enteropathy. Examples of autoimmune disorders include, but are not limited to limit to, autoimmune polyglandular syndrome type 1, autoimmune polyglandular syndrome type 2, diabetes mellitus type 1 (IDDM), Hashimoto-thyroiditis, insulin-autoimmunity syndrome (IAS), idiopathic diabetes insipidus, idiopathic hypoparoscopic, and Graves-Basedow disease. Some examples of autoimmune liver diseases include, but are not limited to, autoimmune hepatitis (AIH type 1, 2, and 3), primary biliary cirrhosis (PBC), and primary sclerosing cholangitis. Examples of autoimmune diseases of the lung include, but are not limited to, Goodpasture's syndrome. An example of an autoimmune disease of the stomach includes, but is not limited to, chronic atrophic gastritis (type A). Examples of neurological autoimmune disorders include, but are not limited to, Guillain-Barré syndrome, neuropathy associated with IgM gammopathy, Lambert-Eaton syndrome, Miller-Fisher syndrome, multiple sclerosis, multifocal motor neuropathy, myasthenia gravis, paraneoplastic neurological syndrome, Rasmussen encephalitis, and stiff man syndrome. Examples of autoimmune diseases of the kidney include, but are not limited to, anti-TBM nephritis, Goodpasture syndrome / anti-GBM nephritis, IgA nephropathy, interstitial nephritis, and proliferative membrane glomerulonephrites. Other diseases that can be caused by an autoimmune reaction include, but are not limited to, Behcet's disease, chronic fatigue immune dysfunction syndrome (CFIDS), Cogan I syndrome, endometriosis, HELLP syndrome, Bechterew's disease, polymyalgia rheumatica, psoriasis, sarcoidosis, and vitiligo.
[0281] The pathological immune response can be systemic or organ specific. That is, for example, the immune response directed at oneself can affect the joints, the skin, the myelin sheath that protects the neurons, kidneys, liver, pancreas, thyroid, adrenals and ovaries.
[0283] In a particular embodiment, the disease is a neurodegenerative disease. Examples of neurodegenerative diseases that can be prevented and / or treated with the aptamer of the invention, the complex of the invention or the composition of the invention include, but are not limited to, Alzheimer's disease and Pick's disease, diffuse disease of the Lewy body, progressive supranuclear palsy (Steel-Richardson syndrome), multisystemic degeneration (Shy-Drager syndrome), chronic epileptic conditions associated with neurodegeneration, motor neuron diseases (amyotrophic lateral sclerosis), sclerosis multiple, degenerative ataxias, basal cortical degeneration, ALS-Parkinson complex, Guam dementia, subacute sclerosing panencephalitis, Huntington's disease, Parkinson's disease, synucleinopathies (including multisystemic atrophy), primary progressive aphasia, striatonigral degeneration, Machado-José disease, or spinocerebellar ataxia type 3 and olivopontocereferis pseudobulbar paralysis, spinal and spi nobulbar muscular atrophy (Kennedy disease), primary lateral sclerosis, familial spastic paraplegia, Werdnig-Hoffmann disease, Kugelberg-Welander disease, Tay-Sach disease, Sandhoff disease, disease familial spasticity, familial spastic disease, Wohlfart-Kugelberg-Welander disease, progressive parasitic spasm disease Leukoencephalopathy, familial dysautonomia (Riley-Day syndrome), or prion diseases (including but not limited to Creutzfeld-Jakob disease, Gerstmann-Strussler-Scheinke disease r, Kuru's disease or insomnia. Additionally, trauma and progressive injury to the nervous system can occur in a number of psychiatric disorders, including but not limited to progressive and impaired forms of bipolar disorder or schizoaffective disorder or schizophrenia, impulse control disorders, obsessive compulsive disorder (OCD), changes in temporal lobe epilepsy and personality disorders.
[0285] In another particular embodiment, the disease is an infectious disease. Examples of infectious diseases that can be prevented and / or treated with the aptamer of the invention, the complex of the invention or the composition of the invention include, without being limited to, AIDS, alveolar hydatid disease (DIA, echinococcosis), amebiasis ( Entamoeba histolytica infection ), Angiostrongylus infection, anisakiasis, anthrax, babesiosis (Babesia infection), Balantidium infection (balantidiasis), Baylisascaris infection, schistosomiasis, Blastocystis hominis infection (blastomicosis) , boreliosis, botulism, Brainerd's diarrhea, brucellosis, bovine spongiform encephalopathy (BSE), candidiasis, capilariasis (Capillaria infection), chronic fatigue syndrome (CFS), Chagas disease (American tranosis) (Varicella-Zoster virus), infection Chlamydia pneumoniae, cholera, Creutzfeldt-Jakob disease (CJD), clonorchiasis (Clonorchis infection), cutaneous larva migrans (CLM) (hookworm infection ), coccidioidomycosis, conjunctivitis, hand, foot and mouth disease (Coxsackie virus infection), cryptococcosis, Cryptosporidium infection (cryptosporidiosis), Culex mosquito (vector of West Nile virus), cyclosporiasis (infection with Cyclospora), cysticercosis (neurocysticercosis), cytomegalovirus infection, dengue, Dipylidium infection (cat and dog tapeworm), Ebola virus infection, entamoeba fevers, and infection (amebiasis), Entamoeba polecki infection, enterobiasis (infection by roundworms), enterovirus infection (not polio), Epstein-Barr virus infection, Escherichia coli infection, foodborne infection, foot and mouth disease, fungal dermatitis, gastroenteritis, group A streptococcal disease, streptococcal disease group B, Hansen's disease (leprosy), Hantavirus pulmonary syndrome, lice infestation (pediculosis), Helicobacter pylori infection, hematological disease, Hendra virus infection, hepatitis (HCV, HBV), herpes zoster infection, herpes zoster, human ehrlichiosis, human parainfluenza virus infection, influenza, isosporiasis (Isospora infection), Lassa fever, leishmania is, Kalaazar (Kala-azar, Leishmania infection), lice (body lice, head lice, pubic lice), Lyme disease, malaria, Marburg hemorrhagic fever, measles, meningitis, mosquito-borne diseases, infection with Mycobacterium avium complex (MAC), Naegleria infection, nosocomial infections, non-pathogenic intestinal amoeba infection, onchocerciasis (river blindness), opisthorciasis (Opisthorcis infection), parvovirus infection, plague, Pneumocystis carinii pneumonia (PCP), polio , Q fever, rabies, respiratory syncytial virus, rheumatic fever, Rift valley fever, river blindness (onchocerciasis), rotavirus infection, roundworm infection, salmonellosis, salmonella enteritidis, scabies, shigellosis, shingles, sleeping sickness, smallpox, streptococcal infection, tapeworm infection (Taenia infection), tetanus, toxic shock syndrome, tuberculosis, ulcers (peptic ulcer disease), fever valley, Vibrio parahaemolyticus, Vibrio vulnificus infection , viral hemorrhagic fever, warts, waterborne infectious diseases, West Nile virus infection (West Nile encephalitis), whooping cough, and yellow fever.
[0287] As shown in the examples of the present description, the aptamers of the invention in an in vitro healing assay were able to activate the migration of the human keratinocyte line HaCaT that stably expresses the FPR2 receptor. Likewise, the aptamers of the invention were also capable of promoting healing in vivo in a humanized animal skin model. Therefore, in another aspect, the present invention relates to the aptamer of the invention, a complex of the invention or the composition of the invention, for use in the treatment of epithelial or dermatological diseases, such as treating a wound.
[0289] Thus, the aptamer of the invention, the complex of the invention or the composition of the invention are useful for the prevention and / or treatment of dermatological diseases including, but not limited to, rosacea, rosacea fulminans, sunburn, psoriasis, hot flashes. associated with menopause, hot flashes and redness associated with hot flashes, erythema associated with hot flashes, hot flashes resulting from an orchiectomy, atopic dermatitis, treatment of redness and itching caused by insect bites, photoaging, seborrheic dermatitis, acne, allergic dermatitis, telangiectasia ( dilations of previously existing small blood vessels) of the face, angioectasia, rhinophyma (hypertrophy of the nose with follicular dilation), acne-like skin eruptions (exudation or scabs), burning or stinging sensation, erythema of the skin, hyperactive skin with dilation of blood vessels in the skin, Lyell syndrome, Stevens-Johnson syndrome, itching local and discomfort associated with hemorrhoids, hemorrhoids, erythema multiforme minor, erythema multiforme major, erythema nodosum, eye swelling, urticaria, pruritus, varicose veins, contact dermatitis, atopic dermatitis, nummular dermatitis, generalized exfoliative dermatitis, stasis dermatitis, lichen chronic simple, perioral dermatitis, pseudofolliculitis, granuloma annulare, actinic keratoses, basal cell carcinoma, squamous cell carcinoma, eczema, dermal wound healing, hypertrophic scars, keloid scars, melanoma, viral warts, photoaging, photodamage, post-inflammatory hyperpigmentation, melasma , other pigmentation disorders, and alopecia (scars and non-scarring forms).
[0291] In a particular embodiment, the disease is dystrophic epidermolysis bullosa (dystrophic epidermolysis bullosa or DEB). Subjects with this disease, apart from chronic skin wounds, show the appearance of blisters on the mucosa (mainly in the oropharynx and esophagus), aberrant scarring that leads to microstomia and esophageal, laryngeal and nasal vestibule stenosis. In addition, the ophthalmologic manifestations of dystrophic epidermolysis bullosa include corneal erosions or blisters and scarring and lesions on the eyelids.
[0292] In the context of the present invention, "treatment of a wound" is understood to mean the acceleration of the healing process of a wound. Non-limiting examples of injuries are:
[0293] - a burn wound, which is injury resulting from exposure to heat, electricity, radiation (for example, sunburn and laser surgery), or caustic chemicals;
[0294] - Grade 1, 2, 3 and 4 ulcers (classification according to their extension), or pressure, venous, arterial, mixed, iatrogenic, diabetic and neoplastic / oncological ulcers (classification according to their origin); mouth ulcers, corneal ulcers, genital ulcers, skin ulcers, peptic ulcers (such as gastric ulcer and duodenal ulcer, among others) (classification according to their location).
[0295] - wounds in diabetes mellitus, which are generally injuries to the feet due to numbness caused by nerve damage (diabetic neuropathy) and decreased blood flow to the legs and feet. The most serious injury is a foot ulcer. Diabetic foot ulcers have a very high risk of being infected, and sometimes they cannot be cured. Foot ulcers that have not healed are a common cause of amputation in people with diabetes, - decubitus injuries, that is, injuries caused by unmitigated pressure on any part of the body, especially portions on bone or cartilaginous areas ,
[0296] - wounds due to an external force that damages the tissue,
[0297] - wounds on the skin due to aging or the environment. This includes, for example, cracks, dry skin, rough skin, and the like.
[0299] The wounds can be an internal wound, an oral wound, a skin wound, an external wound, an ulcer and / or a decubitus ulcer, eye damage, an eye wound, eg conjunctiva. Other conditions that can be treated with the aptamers according to the disclosure include oral ulcers, oral aphthous lesions, glossodynia, burning tongue, psoriasis, eczema, and hair loss.
[0301] These types of skin damage and lesions are known to those skilled in the art. An internal wound is a wound present in the body, for example, due to a surgical incision. An oral wound is a wound present in the oral cavity. A skin wound is a wound on the skin. An external wound must be understood like a wound that is visible and accessible from outside the body. An ulcer is a lesion on the surface of the skin or a mucosal surface. A pressure ulcer is a wound or ulcer caused by prolonged pressure on the skin and tissues when you are in one position for a long period of time, such as lying in bed. The bony areas of the body are the most frequently affected sites, which become ischemic under sustained and constant pressure. Aging of the skin is the change in the appearance of the skin due to time or exposure to the environment or the health status of an individual. Cellulite is the definition used in cosmetics in relation to a flaccid or wavy appearance of the skin (orange peel in Dutch).
[0303] In a particular embodiment of the invention, the aptamer, complex or composition of the invention is used for the treatment of a skin wound. Skin wounds can be wounds in the epidermis or dermis of the skin. There are several types of wounds where the skin or tissue may need repair: abrasions, lacerations, incisions, punctures, and avulsions and burns. In another particular embodiment of the invention, the aptamer, complex or composition of the invention is used for the treatment of an oral wound. Oral wounds are wounds in any part of the oral cavity in which the oral mucosa is damaged. In another particular embodiment of the invention, the aptamer, complex or composition of the invention is used for the treatment of an internal wound, in particular a wound of the internal mucosa. Internal wounds are wounds in which cell layers of endodermal or mesodermal origin are damaged. Examples are injuries to arteries or veins, peritoneum or pericardium.
[0305] In a particular embodiment, the disease is a cardiovascular disease. Examples of cardiovascular diseases include, but are not limited to, aneurysm, stable angina, unstable angina, angina pectoris, angioneurotic edema, aortic valve stenosis, aortic aneurysm, arrhythmia, arrhythmogenic right ventricular dysplasia, arterisclerosis, arterial malformations, fibrillation, atrial fibrillation, brigadilla, thinner, thinner, thinner, scourers, arterial foothills, atrial fibrillation Tamponade, cardiomegaly, congestive cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, carotid stenosis, cerebral hemorrhage, Ebstein syndrome, Diabetes-Strauss complex Eisenmenger, cholesterol embolism, bacterial endocarditis, fibromuscular, parasite, para heart failure, valve disease heart attack, epidural hematoma, subdural hematoma, Hippel-Lindau disease, hyperemia, hypertension, pulmonary hypertension, cardiac hypertrophy, left ventricular hypertrophy, right ventricular hypertrophy, hypoplastic left heart syndrome, hypotension, intermittent claudication, ischemic heart disease, syndrome Klippel-Trenaunay-Weber syndrome, lateral medullary syndrome, long QT syndrome mitral valve prolapse, moyamoya disease, mucocutaneous lymph node syndrome, myocardial infarction, myocardial ischemia, myocarditis, pericarditis, peripheral vascular diseases, phlebitis, polyarteritis nodosa, pulmonary atresia, Raynaud's disease, Sneddon syndrome, superior vena cava syndrome, syndrome X, tachycardia, Takayasu arteritis, hereditary hemorrhagic telangiectasia, telangiectasia, temporal arteritis, areas of paralysis of the parasite, obliteran thromboangiitis, thrombosis , tromosects, vasculiti thrombocytes s, vasospasm, ventricular fibrillation, Williams syndrome, peripheral vascular disease, varicose veins and leg ulcers, deep vein thrombosis, Wolff-Parkinson-White syndrome.
[0307] Throughout the description and claims the word "comprise" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and characteristics of the invention will emerge partly from the description and partly from the practice of the invention. The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention.
[0309] BRIEF DESCRIPTION OF THE FIGURES
[0311] Figure 1. Generation of a keratinocyte line stably expressing the FPR2 receptor A) The HaCaT keratinocyte line was stably transfected using a lentiviral vector containing an expression cassette for human FPR2 (transcript variant 1; Origene) fused with mGFP. The expression of FPR2-GFP on the membrane was checked by direct visualization using an inverted microscope with epifluorescence. B) The WKYMVm peptide (FPR2 agonist) induced significantly (*** p <0.001) calcium response in HaCaT-FPR2-GFP transfectants. Cells were Fura-2 labeled in Ca2 + medium and fluorescence intensities at 340 and 380 nm were analyzed after 60 seconds of stimulation. The bar graph shows the mean ± SD of 4 replicates by condition, n = 4. This effect was totally reversed after the addition of EGTA to the medium.
[0313] Figure 2. Obtaining aptamers for FPR2 using CELL-SELEX. Cells expressing the target protein are incubated in the presence of the aptamer population (initial population RND40 in the first cycle of SELEX or populations obtained after the different cycles). Bound aptamers are amplified by PCR, removing the complementary strand, and subjected to a new cycle of selection (positive selection) or incubated with parental cells that do not express the target protein (negative selection). As many cycles of SELEX are carried out as necessary to obtain a population enriched in specific aptamers against the target molecule.
[0315] Figure 3. Study of the affinity of aptamers against FPR2. The aptamers were incubated with HaCaT-FPR2-GFP or HaCaT cells and those that bind are amplified by quantitative PCR (qPCR). The aptamers that bind with higher affinity are recovered in greater quantity and, consequently, more amplified by PCR, obtaining a lower Ct. The aptamers ApFP3.5a, ApFP3.8a and ApFP4.5b are those that bind with the highest affinity to FPR2.
[0317] Figure 4. Secondary structures of aptamers against FPR2. A) ApFP3.5a Aptamer; B) ApFP3.8a; and C) ApFP4.5b. The prediction of the secondary structures of the aptamers was carried out by bioinformatic analysis of their sequences using the following programs: mFoId (http://unafold.rna.albany.edu),
[0318] RNAfoId (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi) and
[0319] QGRS Mapper (http://bioinformatics.ramapo.edu/QGRS/ analyze.php).
[0321] Figure 5. Colocalization of aptamers against the FPR2 receptor (dark gray) and the protein (light gray).
[0323] Figure 6. FPR2 aptamers function as receptor agonists, inhibiting forskolin-mediated cAMP production in 293 cells. A) 293 cells stably expressing FPR2-GFP were transiently transfected with CRE-luciferase reporter constructs and Renilla-luciferase. 24 hours after transfection, the indicated stimuli were added for 4 hours. Bar graph represents normalized luciferase activity versus Renilla activity for each condition, which is proportional to the amount of cAMP produced. The means were calculated using three biological replicates per condition, n = 3. Error bars represent standard deviation, SD A representative experiment is shown. Statistical significance (*) was determined using Student's t test (p <0.05).
[0325] Figure 7. FPR2 aptamers increase keratinocyte migration similar to the LL37 agonist peptide. The procicatrizing activity of FPR2 agonists was evaluated in an in vitro healing assay using the stable line of HaCaT-FPR2-GFP keratinocytes. Data represent the mean ± SD of 4-6 independent fields. Statistical significance (*) was determined using Student's t test (p <0.05). The panels on the right show representative field images in each condition. Arrows show the direction of migration.
[0327] Figure 8. FPR2 aptamers induce the internalization of CXCR2 and the inhibition of its mRNA expression in THP-1 cells, in a similar way to the peptide agonist LL37. A) FPR2 aptamers, like the LL37 agonist peptide, are capable of inducing the internalization of the CXCR2 receptor in THP-1 cells. Visualization of the receptor was carried out by immunofluorescence using a specific antibody against CXCR2 in permeabilized cells. B) Aptamers against FPR2, like the agonist peptide LL37, significantly inhibit (* p <0.05; ** p <0.005) the expression of CXCR2 mRNA.
[0329] Figure 9. The FP4.5bF aptamer shows procicatrizing activity in a humanized mouse skin model.
[0330] A) Schematic representation of the healing test in the humanized mouse skin model. B) Histological evaluation of healing on day 6. Photographs show representative sections of skin tissues stained with H&E. In mice treated with the ApFP4.5b aptamer, a greater re-epithelialization of the wound area (greater length of the migratory epithelial tongue) is observed in treated mice compared to control mice. C) The wounds analyzed for each treatment are represented as a function of the percentage of re-epithelialization at day 6 after the wound. Each symbol represents an individual mouse. The means of the percentage of re-epithelialization are represented. The error bars represent the standard deviation. Statistical significance (*) was determined using Student's t test (p <0.05).
[0332] EXAMPLES
[0334] The invention will now be illustrated by means of tests carried out by the inventors, which show the effectiveness of the product of the invention.
[0336] In the present invention, specific aptamers have been generated by the Cell-SELEX technique against the GPCR rhodopsin-like receptor (GPCRA) FPR2, for which cell lines have been generated that express this receptor ectopically.
[0338] I. Materials and Methods
[0340] Aptamer Library
[0341] The inventors used the RND40 aptamer library to carry out the selection of specific aptamers against FPR2, supplied by IBA GmbH (Goettingen, Germany). The initial RND40 library is theoretically made up of 1024 single stranded DNA oligonucleotides (ssDNA) with fixed sequence at the ends, of 18 nucleotides each where the respective primers hybridize for amplification by PCR, and a central region of 40 bases of sequence random. In the selections made, 1013 oligonucleotides from this library were used.
[0343] Cells
[0344] The FPR2 receptor expressed in HaCaT cells (HaCaT-FPR2-GFP) is used as a target. The HaCaT human keratinocyte line, as well as the 293 line, were grown in DMEM culture medium with Glutamax (Gibco-BRL, Gaithersburg, MD), supplemented with 10% fetal bovine serum, at 37 ° C in a 5% atmosphere. of CO ² . For the generation of stable FPR2 transfectants in these cell lines, lentiviral transduction was performed using a vector (pLenti-C-mGFP, Origene (Rockville, MD)) that contains the gene that codes for FPR2 fused to the fluorescent protein green GFP under the control of the CMV promoter.
[0346] Selection with HaCaT-FPR2-GFP / HaCaT cells
[0347] For each round of selection, between 8x105 and 10x105 cells were seeded. HaCaTFPR2-GFP in triplicate in wells of P6 plate, 24 hours before the selection assay and incubated at 37 ° C, 5% C02. Next, 1 nmol of aptamers from the RND40 library (or from the population isolated in the previous selection round) were added in 100 pL PBS, previously denatured at 95 ° C for 10 minutes followed by an incubation at 4 ° C for 10 minutes, 300 pL of DMEM medium (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum, 100 U / mL penicillin, 100 pg / mL streptomycin and 25 pg / mL amphotericin were added and applied to the cells. After 1 hour of incubation at 37 ° C, 5% C02, the culture medium with the unbound aptamers was removed, the cells were washed 2 times with PBS and recovered in 500 pL of PBS by centrifugation at 1500 rpm. The cells were centrifuged to remove the supernatant and the aptamers attached to the cells were amplified by PCR to prepare enough for the next round of selection.
[0349] The counter-selection on HaCaT cells from the RND40 aptamer library was performed in the previous preparation of the initial RND40 population and every 3 rounds of selection, with the isolated population from the previous round of selection. For this, between 8x105 and 10x105 HaCaT cells were seeded in triplicate in wells of a P6 plate, 24 hours before the selection test and incubated at 37 ° C, 5% C02. Next, 1 nmol of aptamers from the RND40 library (or from the population isolated in the previous round of selection) were added in 100 pL PBS, previously denatured at 95 ° C for 10 minutes followed by incubation at 4 ° C for 10 minutes. minutes, 300 pL of DMEM medium (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum, 100 U / mL penicillin, 100 pg / mL streptomycin and 25 pg / mL amphotericin were added and applied to the cells. After 1 hour of incubation at 37 ° C, 5% CO ² , the culture medium with unbound aptamers was removed to be used in rounds of selection on HaCaT-FPR2-GFP cells.
[0351] Amplification of selected aptamers
[0352] The selected aptamers were resuspended in a volume of 20 pL of distilled water and were amplified by PCR using the primers, which will correspond to the sequences F3 (GCGGATGAAGACTGGTGT (SEQ ID NO: 9)) and R3 (GTTGCTCGTATTTAGGGC (SEQ ID NO: 10 )) under the conditions of 0.8 pM / primer F3: 0.8 pM / primer R3: 200 mM dNTPs, 2 mM MgCh, 10 U Taq polymerase (Biotools, Spain) in a final volume of 200 pL following the following amplification program: 2 minutes at 95 ° C; 15 cycles of 30 seconds at 95 ° C, 30 seconds at 56 ° C and 30 seconds at 72 ° C; and finally 5 minutes at 72 ° C.
[0354] Characterization of selected aptamers
[0355] Selected aptamers were identified after 3 and 4 rounds of selection by cloning the aptamer population in a plasmid in order to obtain individual aptamers, and subsequent Sanger sequencing.
[0357] The most represented sequences were chemically synthesized by IBA GmbH (Goettingen, Germany) and the affinity, subcellular location and activity of each of the aptamers were studied.
[0359] The nucleotide sequences of the selected aptamers are as follows:
[0361] Aptamer ApFP3.5a GCGGATGAAGACTGGTGTGGGCGGGGGTCTTAGGCTGTACGGGGCTGTTCAGGT GCTTGCCCTAAATACGAGCAAC (SEQ ID NO: 1)
[0363] Aptamer ApFP3.8a GCGGATGAAGACTGGTGTGGGGATCAGGAACTCTGAAATGGCAGTCTATGTTTCA ATGGCCCTAAATACGAGCAAC (SEQ ID NO: 2)
[0365] Aptamer ApFP4.5b GCGGATGAAGACTGGTGTTGTGGCGCTTCGGGCCTGTCCCTTTATATCCGTAGAT TGAGCCCTAAATACGAGCAAC (SEQ ID NO: 3)
[0367] Luciferase Assay to Evaluate cAMP Production
[0368] 293 cells stably expressing the FPR2-GFP receptor were seeded in 96-well plates in complete medium (8.8 x ^{1 0 5} cells per p96 plate). The following day, they were transiently transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA) along with the reporter constructs pCRE-Luc (encoding the cAMP response element CRE and the Luc gene, encoding firefly luciferase) , and pSV40-RL (containing an SV40 promoter and the gene encoding Renilla luciferase). 24 hours after transfection, cells were well stimulated with forskolin (20pM), an activator of adenylate cyclase, either with the peptide LL37 (5pM) + forskolin (20pM) or with two concentrations of the aptamer ApFP4.5b (100pM or 1pM) forskolin (20pM) for 4 hours. For the quantification of the luminescent signal, the Dual-Glo® Luciferase Assay System kit (Promega, Madison. Wl) was used, following the indications of the commercial company. The Luc measurements were normalized against the Renilla measurements.
[0370] In vitro migration tests
[0371] Cells were grown to confluence in 6-well culture plates. At that time the cells were serum starved for 24 hours. The aptamers and the LL37 peptide were tested at concentrations of 100 nM in an in vitro healing assay, where they were added after elimination of the cells that cover half the surface of each well. To evaluate migration, photographs were taken at different times (t = 0 hours - 2 days -4 days - 6 days) after the generation of the wound. Photographs taken on days 4 and 6 after injury were overlaid using Adobe Photoshop software (Adobe Systems, Berkeley, CA). Migration areas were measured using Image J software (NIH Image, Bethesda, MD).
[0373] CXCR2 Internalization Assays
[0374] THP-1 cells grown on coverslips were treated with the LL37 peptide (5 uM) and with the FPR2 aptamers (5 pM), and the expression of CXCR2 was analyzed by immunofluorescence after 5 hours of treatment. Cells were washed with 1x PBS and fixed with 2% paraformaldehyde for 15 minutes. The cells were subsequently permeabilized by incubating with 0.01% saponin for 30 minutes, and non-specific binding sites were blocked by incubation with 10% horse serum and 0.01% saponin diluted in PBS1x for 30 minutes. Cells were incubated with a polyclonal antibody raised against rabbit human CXCR2 (Abcam) for 1 hour at 4 ° C. After washing, cells were incubated with Alexa Fluor 488-conjugated rabbit secondary antibody (Molecular Probes) for 30 minutes. After washing, samples were mounted for viewing using an Axioplan 2 fluorescence microscope (Zeiss, Jena, Germany).
[0376] Inhibition of CXCR2 mRNA expression by qPCR
[0377] The total RNA of the THP-1 cells treated or not with the peptide LL37 (5pM) or with the Specific aptamers of FPR2 (1 pM) were extracted using the miRNeasy Mini Kit (Qiagen, Hilden, Germany). The cDNA generation was obtained using the "high capacity reverse transcription system" kit (Applied Biosystems, Foster City, CA). The products of the RT reaction were used for their amplification by quantitative PCR, using specific oligonucleotides, the Power Sybr Green PCR master mix (Applied Biosystems) and the following amplification conditions: 10 minutes at 950C, followed by 40 cycles of 15 seconds at 950C and 1 minute at 60oC. The reference genes Tata binding protein (TBP) and Ubiquitin C (UBC) were used for the normalization procedures. Simultaneous triplicate reactions were performed for both the target genes and the reference genes for each template cDNA analyzed. The 2-ACT method was used to calculate the relative expression of each target gene (Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods 2001 Dec; 25 (4): 402-8.)
[0379] In vivo healing tests
[0380] Healing experiments were carried out in the humanized skin mouse model as previously described (Escamez et al., 2004, J invest Dermatol. 123 (6): 1182-91). For this, immunodeficient NMRI nu (Rj: NMRI-Foxn1nu / nu) mice of 6 to 8 weeks of age were used, which were transplanted orthotopically with equivalents of bioengineered human skin consisting of a fibrin matrix containing fibroblasts as dermal component and keratinocytes. as part of the epidermal component (Del Rio M, et al. 2002. Hum Gene Ther., 13 (8): 959-68). 10-12 weeks after transplantation, excisional wounds were made in regenerated human skin using 2mm biopsy punches. The administration of the treatments was carried out by means of the implantation of osmotic pumps (Alzet, Cupertino, CA) by subcutaneous route. The ApFP4.5b aptamer dose was 10pM in all mice. Tissues were collected 6 days after wound generation, fixed in formalin, and processed for subsequent histological analysis. The samples were sectioned in their entirety using a microtome and the tissue architecture was subsequently determined in 1 out of 10 sections by staining with hematoxylin-eosin, following standard histological procedures. The percentage of re-epithelialization was determined by microscopy using a grating to measure the proportion of each wound that had been covered by neoepidermis in relation to the total length of the wound.
[0381] Thus, this percentage was calculated by the formula 100x [(wound diameter-epidermal gap) / wound diameter]. The epidermal gap is the distance between the two epithelial tongues. Thus, the center of the wound in each sample was determined, and the different percentages of re-epithelialization were compared between the different samples.
[0383] II. Results
[0385] Assays of binding of aptamers to FPR2 expressed in cells.
[0386] In order to analyze the capacity of the identified aptamers to bind to the FPR2 protein expressed in HaCaT cells, 20 pmol of each of the aptamers identified above were added on a culture of HaCaT-FPR2-GFP cells seeded at 20,000 cells / well in 96-well microtiter plates at a density of 2x10 4 cells / well, 2 days before the start of the assay. After incubation for 30 minutes at 37 ° C, 5% C02, cells were washed, aptamers were recovered with 150 mM imidazole dissolved in PBS with 1 mM MgCL, and qPCR was carried out to determine Ct values. In these experiments, a lower Ct value indicates a greater amount of aptamer bound to the cells. The results obtained show that the aptamers ApFP3.5a, ApFP3.8a and ApFP4.5b (Figure 3) are those that bind with the highest affinity, demonstrating their usefulness in detecting the FPR2 protein. The sequences and secondary structures of these aptamers are shown in Figure 4.
[0388] Subcellular localization by aptacytochemistry.
[0389] Cells expressing the FPR2 receptor fused to green fluorescent protein were incubated in the presence of the AlexaFluor 700-labeled aptamers ApFP3.5a, ApFP3.8a and ApFP4.5b in selection buffer for 1 hour at room temperature. Subsequently, the cells were washed three times with PBS. Finally, cells were mounted on glass slides using a glycerol buffer containing p-phenylenediamine and a 1/750 dilution of Dapi for nuclear staining. Controls were made by omitting the aptamer. The subcellular location of the aptamers was evaluated by fluorescence microcopy. The results show that there is a colocalization of the aptamers with the protein (Figure 5).
[0391] Functionality of the selected aptamers against FPR2.
[0392] In these trials, different approaches were used. First, a typical GPCR assay (CRE-luciferase reporter activity assay), using a stable transfectant of the FPR2 receptor generated in the 293 cell line by lentiviral transduction (Figure 6). This line was transiently transfected with two reporter constructs (CRE-luciferase and Renilla-luciferase). The peptide LL37, an agonist of the FPR2 receptor, allows coupling to the Gi subunit receptor resulting in the inhibition of forskolin-mediated cAMP production. FPR2-specific aptamers are also capable of inhibiting forskolin-mediated cAMP production in a manner similar to LL37 (Table 1). These results reveal the ability of the identified aptamers to activate the FPR2 receptor.
[0396] Table 1. The table indicates the percentages of inhibition of forskolin-mediated cAMP production. The values indicate the mean ± SEM of the data obtained from 3-6 independent experiments.
[0398] Usefulness of selected aptamers in healing.
[0399] In an in vitro healing assay, the three specific aptamers against FPR2 are capable of activating the migration of the human keratinocyte line HaCaT by stably expressing FPR2, like the LL37 peptide (Figure 7). The specific aptamers of FPR2 are also capable of acting as functional ligands of CXCR2, since they induce the internalization of the receptor in the human monocyte line THP-1, as well as the inhibition of the expression of CXCR2 mRNA in this line, in a way similar to what occurs when the LL37 peptide is used as an agonist (Figure 8). Likewise, in vivo tests were carried out with the ApFP4.5b aptamer, which was capable of exerting procicatrizing actions, inducing an improvement in the re-epithelialization process. The tests were carried out using a humanized mouse model in skin, in which excisional wounds were generated. The treatments were administered subcutaneously using osmotic pumps (Figure 9). In Figure 9 it can be seen how in the mice treated with the ApFP4.5b aptamer a greater re-epithelialization of the wound area is observed (longer length of migratory epithelial tongue) in treated mice compared to control mice, demonstrating the effect of the aptamer on healing and demonstrating the utility of the aptamer in the treatment of epithelial wounds.

权利要求:
Claims (20)
[1]
1. A nucleic acid aptamer with the ability to specifically bind to the FPR2 receptor and activate said FPR2 receptor, comprising a nucleotide sequence with a sequence identity of at least 70% with the sequence SEQ ID NO: 1, SEQ ID NO: 2oSEQ ID NO: 3.
[2]
2. Aptamer according to claim 1, wherein the nucleotide sequence has a sequence identity of at least 80, 90, 95, 96, 97, 98 or 99% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
[3]
3. Aptamer according to claim 1 or 2, wherein the nucleotide sequence has 100% sequence identity with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
[4]
4. Aptamer according to any one of claims 1 to 3, wherein the receptor FPR2 is the human receptor FPR2.
[5]
5. Aptamer according to any one of claims 1 to 4, wherein the nucleic acid is DNA.
[6]
6. A complex comprising an aptamer according to any one of claims 1 to 5 and a functional group.
[7]
7. Complex according to claim 6, wherein the functional group is a detectable reagent, a drug or a nanoparticle.
[8]
8. A pharmaceutical composition comprising an aptamer according to any one of claims 1 to 5, and / or a complex according to claim 6 or 7, together with a pharmaceutically acceptable carrier, excipient or vehicle.
[9]
In vitro use of an aptamer according to any one of claims 1 to 5, or a complex according to claim 6 or 7, to detect the FPR2 receptor.
[10]
10. Use according to claim 9, wherein the detection of the FPR2 receptor is performed by a method selected from the group consisting of ELONA, aptacytochemistry, aptahistochemistry and flow cytometry.
[11]
11. In vitro use of an aptamer according to any one of claims 1 to 5, or a complex according to claim 6 or 7, to activate the FPR2 receptor.
[12]
12. In vitro method for the detection of the FPR2 receptor in an isolated biological sample from a subject comprising
(a) contacting said sample with an aptamer according to any one of claims 1 to 5, or a complex according to claim 6 or 7,
(b) separating the aptamer or complex not bound to the FPR2 receptor, and
(c) detecting the presence of the aptamer or complex bound to the FPR2 receptor present in the sample.
[13]
13. Method according to claim 12, wherein the detection is carried out by means of fluorescence.
[14]
In vitro method of activating the FPR2 receptor in a biological sample isolated from a subject comprising contacting said sample comprising the FPR2 receptor with an aptamer according to any one of claims 1 to 5, or a complex according to claim 6 or 7, under suitable conditions to activate the FPR2 receptor.
[15]
15. Method according to any one of claims 12 to 14, wherein the subject is a human being.
[16]
16. Method according to any one of claims 12 to 15, wherein the isolated biological sample is blood, plasma, serum or cerebrospinal fluid.
[17]
17. An aptamer according to any one of claims 1 to 5, or a complex according to claim 6 or 7, or a pharmaceutical composition according to claim 8, for use in treating a wound.
[18]
18. An aptamer according to any one of claims 1 to 5, or a complex according to claim 6 or 7, or a pharmaceutical composition according to claim 8, for use in the prevention and / or treatment of diseases characterized by a decrease in the expression of the FPR2 receptor, and / or a decrease in the activation of the FPR2 receptor and / or an absence of the natural ligand of the FPR2 receptor and / or a low amount of the natural ligand of the FPR2 receptor with respect to the amount of natural ligand in a subject in normal health or healthy conditions.
[19]
19. Aptamer, complex or composition for use according to claim 18, wherein the disease is selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a neurodegenerative disease, a cardiovascular disease, an infectious disease, a disease ocular and epithelial disease.
[20]
20. Aptamer, complex or composition for use according to claim 19, wherein the epithelial disease is dystrophic epidermolysis bullosa.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US7025987B2|2006-04-11|Delivery system for nucleic acids

---

JP2021152022A|2021-09-30|Cell penetrating antibodies

---

ES2864639T3|2021-10-14|Therapeutic agents for the treatment of diseases associated with unwanted cell proliferation

---

JP2011520914A|2011-07-21|Treatment of metastatic tumor

---

JP4843487B2|2011-12-21|Use of PAK inhibitors to treat joint diseases

---

JP2007512847A|2007-05-24|HIF oligonucleotide decoy molecule

---

JP2021072835A|2021-05-13|Pdgf and vegf aptamers having improved stability and their use in treating pdgf and vegf mediated diseases and disorders

---

Li et al.2013|A novel dendritic nanocarrier of polyamidoamine-polyethylene glycol-cyclic RGD for “smart” small interfering RNA delivery and in vitro antitumor effects by human ether-à-go-go-related gene silencing in anaplastic thyroid carcinoma cells

---

JP2014504258A|2014-02-20|Selective proton-coupled folate transporter and folate receptor and inhibitor compounds of GAFTase and / or other folate-metabolizing enzymes and methods of use thereof

---

Lee et al.2017|Suppression of human arthritis synovial fibroblasts inflammation using dexamethasone-carbon nanotubes via increasing caveolin-dependent endocytosis and recovering mitochondrial membrane potential

---

TW201103983A|2011-02-01|Aptamer against chymase and use thereof

---

JP2018525001A|2018-09-06|Therapeutic cell internalization conjugates

---

RU2709718C2|2019-12-19|Aptamers specific for tlr-4, and use thereof

---

WO2007072221A2|2007-06-28|Surface marker-directed cancer therapeutics

---

Bram et al.2007|C421 allele-specific ABCG2 gene amplification confers resistance to the antitumor triazoloacridone C-1305 in human lung cancer cells

---

ES2799098B2|2021-12-10|AGONIST APTAMEROS OF THE FPR2 RECEPTOR AND USES OF THEM

---

US8187828B2|2012-05-29|Use of PAK inhibitor for the treatment of a joint disease

---

KR20200068647A|2020-06-15|RNA aptamer for transferrin receptor |

---

US20210046105A1|2021-02-18|Compositions and methods for targeting cells

---

US20070122830A1|2007-05-31|Prohibitin-directed diagnostics and therapeutics for cancer and chemotherapeutic drug resistance

---

JP2021534158A|2021-12-09|NLRP3 modulator of imidazole [4,5-c] quinoline derivative

---

CN107106697B|2021-06-18|PDGFR RNA aptamer

---

WO1997010840A1|1997-03-27|Anti-inflammatory antisense drug

---

WO2012072850A2|2012-06-07|Compounds for treating cardiac damage after ischaemia/reperfusion

---

JP7034495B2|2022-03-14|Aptamers used to inhibit and / or suppress TLR9 activation

同族专利:

---

公开号 | 公开日

---

ES2799098B2|2021-12-10|

---

WO2020249841A1|2020-12-17|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

US20170216326A1|2013-03-06|2017-08-03|Allergan, Inc.|Use of agonists of formyl peptide receptor 2 for treating dermatological diseases|

---

EP1358888A1|2002-02-28|2003-11-05|Robert Bals|The human peptide antibiotic LL-37/hCAP-18 is an inducer of angiogenesis|

---

SE0300207D0|2003-01-29|2003-01-29|Karolinska Innovations Ab|New use and composition|

---

WO2009046881A1|2007-09-11|2009-04-16|Mondobiotech Laboratories Ag|Use of a peptide combination including c-peptide, as a therapeutic agent|

---

法律状态:
2020-12-14| BA2A| Patent application published|Ref document number: 2799098 Country of ref document: ES Kind code of ref document: A1 Effective date: 20201214 |

---

2021-12-10| FG2A| Definitive protection|Ref document number: 2799098 Country of ref document: ES Kind code of ref document: B2 Effective date: 20211210 |

优先权:

---

申请号 | 申请日 | 专利标题

---

ES201930524A|ES2799098B2|2019-06-10|2019-06-10|AGONIST APTAMEROS OF THE FPR2 RECEPTOR AND USES OF THEM|ES201930524A| ES2799098B2|2019-06-10|2019-06-10|AGONIST APTAMEROS OF THE FPR2 RECEPTOR AND USES OF THEM|

---

PCT/ES2020/070378| WO2020249841A1|2019-06-10|2020-06-09|Fpr2 receptor agonist aptamers and uses thereof|